Overview

Brief Summary

The Marsh Fritillary occurs in very different types of habitat, like moist, sheltered grasslands, along the edges of raised bogs and on dry, calcareous grasslands. The foodplants are Devil’s-bit Scabious (Succisa pratense), Small Scabious (Scabiosa columbaria), Field Scabious (Knautia arvensis) and teasels (Dipsacus spp.), on the Iberian peninsula Honeysuckle (Lonicera spp.). The eggs are laid in large clumps under the leaves. The caterpillars spin a substantial nest between the leaves of the foodplants, feeding in it and also hibernating communally there. However, later they are solitary and look for places deep in the vegetation in which to pupate. The Marsh Fritillary has one generation a year. This is a very variable species with many subspecies. In Spain and Portugal Euphydryas aurinia beckeri is larger and brighter than most subspecies, with bold, black markings. Euphydryas aurinia debilis is usually found above 1800 m in the Alps and Pyrenees. It is smaller, with a lot of black markings and hardly any orange. Euphydryas aurinia provincialis occurs in the south of France and is pale orange. Euphydryas aurinia hibernica occurs in Ireland and is very distinctive with prominent red and heavy black markings. Habitats: humid grasslands and tall herb communities (26%), mesophile grasslands (21%), dry calcareous grasslands and steppes (9%), broad-leaved deciduous forests (7%), heath and scrub (5%), alpine and subalpine grasslands (5%).

  • Anthes N, Fartmann T, Hermann G (2003a) Wie lässt sich der Rückgang des Goldenen Scheckenfalters (Euphydryas aurinia) in Mitteleuropa stoppen? Erkenntnisse aus populationsökologischen Studien in voralpinen Niedermoorgebieten und der Arealentwicklung in Deutschland. Naturschutz und Landschaftsplanung 35: 279-287.
  • Anthes N, Fartmann T, Hermann G, Kaule G (2003b) Combining larval habitat quality and metapopulation structure – the key for successful management of pre-alpine Euphydryas aurinia colonies. Journal of Insect Conservation 7: 175-185. doi: 10.1023/A:1027330422958
  • Barnett LK, Warren MS (1995) Species Action Plan: Marsh Fritillary, Euphydryas aurinia. Butterfly Conservation, Wareham, Dorset, UK, 29 pp.
  • Betzholtz PE, Ehrig A, Lindeborg M, Dinnetz P (2007) Food plant density, patch isolation and vegetation height determine occurrence in a Swedish metapopulation of the marsh fritillary Euphydryas aurinia (Rottemburg, 1775) (Lepidoptera, Nymphalidae). Journal of Insect Conservation 11: 343-350. doi: 10.1007/s10841-006-9048-3
  • Botham MS, Ash D, Aspey N, Bourn NAD, Bulman CR, Roy DB, Swain J, Zannese A, Pywell RF (2011) The effects of habitat fragmentation on niche requirements of the marsh fritillary, Euphydryas aurinia, (Rottemburg, 1775) on calcareous grasslands in southern UK. Journal of Insect Conservation 15: 269-277. doi: 10.1007/s10841-010-9344-9
  • Bulman CR, Wilson RJ, Holt AR, Galvez Bravo L, Early RI, Warren MS, Thomas CD (2007) Minimum viable metapopulation size, extinction debt, and the conservation of a declining species. Ecological applications : a publication of the Ecological Society of America 17: 1460-1473.
  • Hula V, Konvička M, Pavlicko A, Fric Z (2004) Marsh Fritillary (Euphydryas aurinia) in the Czech Republic : monitoring, metapopulation structure, and conservation of an endangered butterfly. Entomologica Fennica 15: 231-241.
  • Joyce DA, Pullin AS (2003) Conservation implications of the distribution of genetic diversity at different scales: a case study using the marsh fritillary butterfly (Euphydryas aurinia). Biological Conservation 114: 453-461. doi: 10.1016/S0006-3207(03)00087-9
  • Junker M, Schmitt T (2010) Demography, dispersal and movement pattern of Euphydryas aurinia (Lepidoptera: Nymphalidae) at the Iberian Peninsula: an alarming example in an increasingly fragmented landscape? Journal of Insect Conservation 14: 237–246. doi: 10.1007/s10841-009-9250-1
  • Konvička M, Hula V, Fric Z (2003) Habitat of pre-hibernating larvae of the endangered butterfly Euphydryas aurinia (Lepidoptera : Nymphalidae): What can be learned from vegetation composition and architecture? European Journal of Entomology 100: 313–322.
  • Liu WH, Wang YF, Xu RM (2006) Habitat utilization by ovipositing females and larvae of the Marsh fritillary (Euphydryas aurinia) in a mosaic of meadows and croplands. Journal of Insect Conservation 10: 351-360. doi: 10.1007/s10841-006-9009-x
  • Munguira ML, Martín J, García-Barros E, Viejo JL (1997) Use of space and resources in a Mediterranean population of the butterfly Euphydryas aurinia. Acta Oecologica-International Journal of Ecology 18: 597-612.
  • Porter K, Ellis S (2011) Securing viable metapopulations of the Marsh Fritillary butterfly, Euphydryas aurinia, (Lepidoptera: Nymphalidae) in Northern England. Journal of Insect Conservation 15: 111-119. doi: 10.1007/s10841-010-9328-9
  • Saarinen K, Jantunen J, Valtonen A (2005) Resumed forest grazing restored a population of Euphydryas aurinia (Lepidoptera : Nymphalidae) in SE Finland. European Journal of Entomology 102: 683-690.
  • Schtickzelle N, Choutt J, Goffart P, Fichefet V, Baguette M (2005) Metapopulation dynamics and conservation of the marsh fritillary butterfly: Population viability analysis and management options for a critically endangered species in Western Europe. Biological Conservation 126: 569-581. doi: 10.1016/j.biocon.2005.06.030
  • Smee M, Smyth W, Tunmore M, Ffrench-Constant R, Hodgson D (2011) Butterflies on the brink: habitat requirements for declining populations of the marsh fritillary (Euphydryas aurinia) in SW England. Journal of Insect Conservation 15: 153-163. doi: 10.1007/s10841-010-9334-y
  • Stefanescu C, Penuelas J, Sardans J, Fillela I (2006) Females of the specialist butterfly Euphydrias aurinia (Lepidoptera: Nymphalinae: Melitaeini) select the greenest leaves of Lonicera implexa (Caprifoliaceae) for oviposition. European Journal of Entomology 103: 569-574.
  • Wang RJ, Wang YF, Chen JJ, Lei GC, Xu RM (2004) Contrasting movement patterns in two species of chequerspot butterflies, Euphydryas aurinia and Melitaea phoebe, in the same patch network. Ecological Entomology 29: 367-374.
  • Warren MS (1994) The Uk Status and Suspected Metapopulation Structure of a Threatened European Butterfly, the Marsh Fritillary Eurodryas aurinia. Biological Conservation 67: 239-249
  • Zimmermann K, Blazkova P, Cizek O, Fric Z, Hula V, Kepka P, Novotny D, Slamova I, Konvička M (2011a) Demography of adults of the Marsh fritillary butterfly, Euphydryas aurinia (Lepidoptera: Nymphalidae) in the Czech Republic: Patterns across sites and seasons. European Journal of Entomology 108: 243-254.
  • Zimmermann K, Fric Z, Jiskra P, Kopeckova M, Vlasanek P, Zapletal M, Konvička M (2011b) Mark-recapture on large spatial scale reveals long distance dispersal in the Marsh Fritillary, Euphydryas aurinia. Ecological Entomology 36: 499-510. doi: 10.1111/j.1365-2311.2011.01293.x
Creative Commons Attribution 3.0 (CC BY 3.0)

© Chris van Swaay

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Euphydryas aurinia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 75
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Euphydryas aurinia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAGCAGGAATAATAGGAACTTCATTAAGTCTTTTAATTCGAACTGAATTAGGAAATCCAGGTTCATTAATTGGGGAT---GATCAAATTTATAATACTATTGTTACAACTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATCCCACTAATATTGGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTGCTACCCCCTTCATTAATATTATTAATTTCTAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAATTTACCCCCCTCTTTCTTCCAATATCGCCCATAGAGGATCTTCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGTATCAATAATATATCTTTTGATCAAATACCTTTATTCGTTTGAGCAGTAGGTATTACAGCCCTTCTTTTATTATTATCACTCCCAGTATTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATATTAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTCTTTTATACCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCAGGATTCGGTATAATTTCCCATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATGTTTAGGTATAATTTATGCAATAATAGCAATTGGATTATTAGGATTTATTGTCTGAGCTCATCATATATTTACAGTTGGTATAGATATTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Marsh Fritillary

The Marsh Fritillary, Euphydryas aurinia, is a butterfly of the Nymphalidae family. It is widespread in the Palaearctic region from Ireland in the West to Yakutia in the East, and to North-west China and Mongolia in the South. E. aurinia is represented by many subspecies. The most widely accepted are:

  • E. a. barraguei (Betz, 1956) Algeria

but the total number of described subspecies is much higher especially in the Eastern Palaearctic. The insect may be best considered a superspecies.

The larvae are recorded as feeding on Succisa pratensis and species of Digitalis, Plantago,Veronica (V.dubravnaya, etc.), Geranium,Sambucus, Gentiana, Valeriana, Lonicera, Filipendula, Spiraea and Viburnum.

The Marsh Fritillary in the British Isles[edit]

The Marsh Fritillary is in decline in Europe and one of 11 butterflies covered by the United Kingdom Biodiversity Action Plan. Within the British Isles, it is more frequent in the south and west.[1]

The adult butterflies are marked in checkered marking of gold and brown with a black background. The underside of the wings is patterned with yellow orange and black without any silver coloration at all. The eggs are yellow identified by being in a large batch,and the larvae are black.

The Marsh Fritillary is usually to be found in damp heathy grasslands which are called rhos pastures from the Welsh word rhos meaning heath, but the species does exist in other types of habitats which are drier, like neutral grasslands or dry calcareous grasslands. Small populations may be seen where there is not a lot of the larval foodplant present. Small populations can be an important element of the ecology because they can produce lots of mobile individuals which can found other populations.

The Marsh Fritillary is protected under British Law. It is listed under Schedule 5 of the Wildlife and Countryside Act, also the EU Habitats and Species Directive (Annex II).

The butterflies fly from the April until July depending on latitude and altitude.

Habitats[edit]

Typical habitat (Connemara, Ireland).

Food plants[edit]

The main food plant of the Marsh Fritillary is the Devil's bit scabious, Succisa pratensis, but can also include the field scabious Knautia arvensis and the small scabious Scabiosa columbaria.

Life cycle[edit]

Lateral view - Northern Italy
Mating
Eggs
Larva
Pupa

The eggs are laid in groups on the underside of the leaves in May and June. Up to 350 are laid in a single batch. They turn from pale yellow when first laid, turn bright yellow, then crimson, and finally to dark grey just prior to hatching. The caterpillars hatch from the end of June onwards. The young caterpillars live in communal webs that are spun across the foodplant and these become conspicuous by the end of August. In the autumn they make stronger webs, closer to the ground usually within a dense grass tussock, where they will start to hibernate. In the spring the caterpillars start to disperse from their communities after their last molt. They change colour from brown to black and may be occasionally seen basking in the sun. They need to be warm in order to eat. The caterpillars are liable to be attacked by the parasitoid wasp Apanteles bignellii, especially in warm spring weather.[2] Pupae form from mid April, low down deep within grass tussocks or dead leaves. Adults emerge from mid-June to mid July.

Metapopulations[edit]

Research work on the population dynamics of the Marsh Fritillary has shown that they live in metapopulations. A metapopulation is defined as a collection of local populations that are connected together as a result of occasional dispersal. Amongst these some will disappear and others will be founded.

Usually the Marsh Fritillary lives in small populations that tend to die out and new populations are founded from nearby sites. An important feature of metapopulations is that there will always be empty habitat within the system. It is possible for the majority of the habitat patches to be empty. The security of suitable places where the butterfly does not presently occur is essential to its survival in the long term.

Management[edit]

The aim is to produce an uneven patchwork of short and long vegetation by the end of the grazing period, between 8 and 25 cm. This is to allow the food plant to grow.

This can be achieved through:

  • Low intensity grazing (also known as extensive grazing) using cattle. Sheep are not so good as they are more efficient at removing wild plants.
  • Burning - not so good as may kill a proportion of Marsh Fritillary

Monitoring and indicators of success[edit]

  • The frequency of larval webs in 3m strip can be counted during random walk of at least 100 paces in October - February. The larval web present in at least 30% of paces.
  • Frequency of flowers (adult nectar sources) counted within 3m strip during random walk in May - June should be at least 50%
  • Frequency of Succisa pratensis (larval foodplant) counted within 3m strip during a random walk of at least 100 paces. Succisa pratensis in at least 80% of paces. No more than 25% reduction in abundance
  • Average height of sward measured by drop disc or by estimation. There should be a mosaic of sward heights of between 8 – 20 cm during May - September
  • Sward structure monitoring. The butterflies require varied habitat structure: basking sites, supplies of nectar, roosting area.

Example sites[edit]

The Devon Wildlife Trust owns a number of sites for which it monitors this species. Examples include Stowford Moor (near Holsworthy, Devon), Dunsdon nature reserve (near Bude), Mambury Moor (near Great Torrington), Vealand Farm nature reserve (near Holsworthy), Volehouse Nature Reserve (near Holsworthy). In 2009, counts of number of species had significantly increased from years 2007 and 2008.[3]

References[edit]

  1. ^ NBN gateway: Euphydryas aurinia
  2. ^ http://www.learnaboutbutterflies.com/Britain%20-%20Euphydryas%20aurinia.htm
  3. ^ Wild Devon The Magazine of the Devon Wildlife Trust,page 8 Winter 2009 edition

Further references[edit]

Aldwell, B. and Smyth, F. 2013. The Marsh Fritillary (Euphydryas aurinia (Rottemburg, 1775)) (Lepidoptera: Nymphalidae) in Co. Donegal. Ir. Nat. J. 32: 53 - 63.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!