Overview

Brief Summary

WhyReef - Lifestyle

Like snails and other sea slugs, the magnificent sea slug is a gastropod. Most gastropods have a hard shell outside (not the magnificent sea slug, though) and a muscular foot that they use to move around.

Though it can’t see, it has two tentacles on its head called rhinophores and two near its mouth called oral tentacles, which allow it to smell, taste, and feel its way around the reef. The feathery parts on the back of its body are gills that it uses to breathe in water.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

WhyReef - Fun Facts

Like most sea slugs, or nudibranchs, the magnificent sea slug is very colorful. But its beauty is only skin deep: its colors warn other animals that it is toxic and bad to eat. It gets its toxins from the food it eats, mostly sponges.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

WhyReef - Menu

The magnificent sea slug eats sponges, but it will also eat its own kind—other sea slugs— if they come across its path. Since it only eats other animals, the magnificent sea slug is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chromodoris magnifica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGCGTTGACTTTTTTCGACAAACCATAAAGATATTGGAACTTTGTACATCTTTTTAGGTATATGATGTGGATTAGTGGGTACAGGGCTAAGACTCCTAATTCGTTTTGAATTAGGAACGGCCGGAGCATTTTTAGGTGACGATCACTTTTATAATGTGATTGTTACGGCTCACGCTTTTGTAATAATTTTTTTTATAGTAATACCATTAATAATTGGAGGGTTTGGAAACTGGATAGTCCCATTATTGATTGGGGCCCCAGATATAAGATTTCCTCGGATAAATAATATAAGTTTTTGGTTACTTCCCCCTTCTTTTATTTTATTATTGTGTTCTACCTTAATAGAAGGAGGAGCCGGGACGGGTTGAACTGTATATCCGCCTCTTTCTGGGCCTGTTGCCCACGGGGGAACATCAGTAGATCTAGCAATTTTTTCGCTCCACCTAGCTGGTGCTTCTTCTCTTTTAGGGGCAATTAATTTTATTACTACAATTTTCAATATGCGTTCTACGGCAATAACAATAGAACGTTTAAGATTGTTTGTATGATCGGTATTGGTAACTGCTTTTCTTTTACTCTTATCACTTCCTGTATTGGCAGGGGCAATTACTATGCTTTTAACAGACCGAAATTTCAATACTAGGTTTTTTGATCCTGCAGGAGGTGGTGACCCTATTTTATACCAACATCTCTTTTGATTTTTTGGTCATCCCGAAGTATACATTCTTATTCTTCCTGGATTTGGAATAATTTCTCATATTCTTAGTAATTTTACTTTAAAACCAGCCTTCGGAACTTTAGGAATAATTTATGCCATAATTTCAATTGGTATTTTAGGATTCATTGTATGAGCTCATCATATATTTACAGTAGGAATGGATGTAGATACTCGTGCTTATTTTACTGCAGCTACTATGGTAATTGCGGTTCCTACAGGAATTAAGGTATTTAGATGGTTAATAACTCTTTACGGAAGCCGTAGTCCTTTTGATGCCTCTATATATTGGGTATTAGGATTTATTTTCTTATTTACTTTAGGGGGTTTAACTGGAATCGTGCTTTCAAACTCCTCGTTAGATATTGTTCTGCATGATACTTATTATGTAGTGGCTCATTTTCACTATGTCTTATCCATAGGAGCTGTGTTTGCCATTTTTGGAGGATTTGTGTATTGGTTCCCATTAATAACAGGTTTAACGTTGCATGAACGATGGGCTAAATCACATTTTTTGGTAATGTTCTGTGCAGTAAATTTAACCTTTTTTCCTCAACACTTTTTAGGGTTAGCAGGTATACCACGTCGATACTCAGATTATCCTGATGCTTACTTTAAGTGAAATCAGGTATCGTCCTTTGGGTCTTTATTTTCAATTTTCGCGGTATTAATATTTATTTTTATTTTATGGGAAGCATTAGTTAGACAACGGGGTGTGTTGTTCACAAAAGCTCCTTCAATTTCCCGAGAATGAGAAGAAGTTCTTCCTCTTGATTTTCACAGTAATACTGAGTGTTCAGTAACAGCTAGAAATTAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chromodoris magnifica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

WhyReef - Threats

Reefs are in danger, and that means so is the home of the magnificent sea slug!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chromodoris magnifica


Chromodoris magnifica is a species of nudibranch, a shell-less marine gastropod mollusk in the family Chromodorididae.

Distribution[edit]

This nudibranch is found in the central area of the Indo-Pacific region from Indonesia and the Philippines to New Guinea and Eastern Australia.[2]

Description[edit]

Chromodoris magnifica can reach a maximum size of 5 cm length.[3] The body is elongate with a foot which is distinct from the upper body by a skirt like mantle hiding partially the foot. The branched gills and the rhinophores are orange colour and can be withdraw in specific pockets under the skin in case of danger.[4] The specific epithet magnifica in Chromodoris magnifica means magnificent, so-named because of this nudibranch's striking, vibrant colors.

The background colour of the body is bluish which intensity varies from a specimen to another. On the mantle, the bluish area is outlined by two continuous black lines and a median continuous line cross it also. These bluish parts are often marked with dash-like black lines. The margin of the mantle is bordered with a large white band with a central orange colour line, the width of these lines is variable for each specimen.

The foot has three black continuous longitudinal lines. Its background colour is the same as its mantle. The margin of basis foot is outlined by an orange and a white line.

This species is easily confused with the similar looking Chromodoris quadricolor. Chromodoris magnifica can be distinguished by its submarginal orange border.[5]

Ecology[edit]

Chromodoris magnifica feeds on sponges and has been observed feeding on red sponges of the genus Negombata.

References[edit]

  1. ^ (French) Quoy, J. R. & Gaimard, J. P. (1832). Voyage de decouvertes de L'Astrolabe pendant les annees 1826-1827-1828-1829, sous le commandement de M.J. Dumont D'Urville, Zoologie, 2: 1-686.
  2. ^ http://www.seaslugforum.net/find/chrmag
  3. ^ http://fran.cornu.free.fr/affichage/affichage_nom.php?id_espece=1305&num_visu=2
  4. ^ http://www.seaslugforum.net/find/rhinonud
  5. ^ http://www.seaslugforum.net/message/15098 (accessed 17 December 2009)

Books[edit]

  • Debelius, Helmut, 2001, Nudibranchs and Sea Snails: Indo-Pacific Field Guide, IKAN - Unterwasserarchiv, Frankfurt, Germany.
  • P.L.Beesley,G.J.B. Ross,A.Wells,Mollusca-The southern synthesis, vol.5, CSIRO, 1998,ISBN 0-643-05756-0
  • David Behrens, Nudibranch behaviour, Newworld Publication INC., 2005, ISBN 978-1878348418
  • Gary Cobb & Richard Willan, Undersea jewels- a colour guide to nudibranchs, Australian Biological Resources Study, 2006, ISBN 0642568472
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!