Overview

Comprehensive Description

Strumigenys dicomas Fisher HNS sp. n. (Figs 394, 416)

HOLOTYPE WORKER. TL 3.6, HL 1.01, HW 0.93, CI 93, ML 0.48, MI 47, SL 0.63, SI 67, PW 0.42, AL 0.86. With the above characters and the following. Outer margins of mandibles shallowly convex in full-face view. Upper scrobe margin bordered by a conspicuous laminate rim or flange throughout its length; eyes partially visible in full-face view. Leading edge of scape with a row of slender hairs which are slightly flattened or spoon-shaped apically. Cephalic dorsum clothed with inconspicuous small curved spatulate to narrowly spoon-shaped ground-pilosity; the upper scrobe margin fringed with hairs which are similar in shape and size as those on the dorsum; apicoscrobal hair absent. Cephalic dorsum with 6 simple standing hairs arranged in a transverse row close to the occipital margin; many paratypes have a more anteriorly situated pair near the highest point of the vertex. Dorsum of head reticulate-punctate, middorsum rugulose in larger specimens. Mesonotum with a single pair of stout standing hairs situated on anterior margin. Propodeum without a pair of short, fine, posteriorly curved hairs immediately anterior of propodeal spines. Ground-pilosity on alitrunk as on head but sparser. With the alitrunk in profile the posterior portion of the mesonotum sharply depressed, the metanotal groove represented by a shallow impression. Pronotal humeri rounded. Dorsolateral margin of posterior pronotum bluntly marginate. Anterior mesonotum with a distinct narrow carina above the mesothoracic spiracle. Propodeal spine long and slender, recurved, especially near the apex; propodeal lamella absent. Alitrunk dorsum reticulate-punctate; lateral margins of pronotum rugulose; pleurae more or less smooth centrally with peripheral reticulate-punctate sculpture. Petiole node in dorsal view finely reticulate-punctate, exposed area of cuticle slightly broader than long. Postpetiole superficially reticulate-punctate. Spongiform appendages of petiole weakly developed, with a narrow ventral curtain. Postpetiole with small but distinct lateral and ventral spongiform lobes. Basigastral costulae short and distinct; gaster smooth and shiny when clean. Dorsal surfaces of petiole, postpetiole, and gaster with stout standing hairs which are swollen apically. Colour dull yellow to light medium brown.

PARATYPE WORKERS. TL 3.6 - 4.2, HL 1.00 - 1.17, HW 0.91 - 1.11, CI 90 - 95, ML 0.48 - 0.55, MI 46 - 49, SL 0.62 - 0.70, SI 63 - 68, PW 0.41 - 0.49, AL 0.81 - 1.02 (9 measured). As holotype.

Holotype worker, Madagascar: 9.2 km. WSW Befingotra, Res. Anjanaharibe-Sud, 14 ° 45 ' S, 49 ° 28 ' E, 1200 m., 9. xi. l 994, sifted litter (leaf mold rotten wood), montane rainforest # 1192 (12) - 14 (B. L. Fisher) (MCZ). Paratypes. 9 workers and 2 queens (dealate) with same data as holotype but coded (3) - 9, (23) - 9, (24) - 9, (24) - 10, (29) - 8, (36) - 9, (40) - 4, (50) - 10, (L. O.) - IO (BMNH, SAM).

NON-PARATYPIC MATERIAL EXAMINED. Madagascar: R. S. Manongarivo, 10.8 km. 229 ° SW Antanambao, 400 m. (B. L. Fisher); R. S. Manongarivo, 12.8 km. 228 ° SW Antanambao, 780 m. (B. L. Fisher); R. S. Manongarivo, 14.5 km. 220 ° SW Antanambao, 1175 m. (B. L. Fisher); 9.2 km. WSW Befingotra, Res. Anjanaharibe-Sud, 1280 m. (B. L. Fisher); RNI Marojejy, 375 m., 665 m. (G. D. Alpert); 55 km. S Antalaha, Nosy Ngontsy, 1 m. (Alpert ei al.); 19 km. ESE Maroantsetra, 350 m. (P. S. Ward); 5.3 km. SSE Ambanizana, Andranobe, 425 m. (B. L. Fisher); 6.9 km. NE Ambanizana, 825 m. (B. L. Fisher); Nosy Mangabe, 20 m. (P. S. Ward); S. F. Tampolo, 10 m. (B. L. Fisher); Causse de Kelifely (A. Peyrieras); Route d'Andriamena (A. Peyrieras); Foret d'Andranobe, Road to Andriamena 1200 m. (J. - M. Betsch); F. C. Sandranantitra 450 m. (H. J. Ratsirarson); F. C. Didy 960 m. (H. J. Ratsirarson); F. C. Andrianantantely 530 m. (H. J. Ratsirarson); P. N. Mantadia 895 m. (H. J. Ratsirarson); Perinet (W. L. Brown); Andasibe, 870 m. (Alpert et al.); For. d'Ambatofitorahana 293 - 294 km. on route national no. 7, 1800 m. (J. - M. Betsch); 3 km. W Ranomafana, 950 m. (P. S. Ward); Ranomafana Nat. Park, Maharira Forest, 1130 m. (E. Rajeriarison); Ranomafana Nat. Park Andranobe, Vohiparara Forest, 1160 m. (E. Rajeriarison); 45 km. S Ambalavao, 785 m. (B. L. Fisher); 11 km. NW Enakara, Res. Andohahela, 800 m. (B. L. Fisher).

The non-paratypic material shows greater size variation than the type-series alone: HL 0.86 - 1.09, HW 0.75 - 1.04, CI 87 - 95, ML 0.41 - 0.52, MI 42 - 50, SL 0.53 - 0.68, SI 61 - 75 (12 measured), but otherwise matches all diagnostic characters.

S. dicomas HNS is widely distributed but easily recognized. In the Malagasy region it is the only species with mandible shape and dentition as described in the diagnosis above.

  • Bolton, B. (2000): The ant tribe Dacetini. With a revision of the Strumigenys species of the Malgasy Region by Brian L. Fisher, and a revision of the Austral epopostrumiform genera by Steven O. Shattuck. Memoirs of the American Entomological Institute 65, 1-1028: 655-656, URL:http://hdl.handle.net/10199/15409
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

Strumigenys dicomas Bolton, 2000: 655, figs. 394, 416 (w.q.) MADAGASCAR. AntCat AntWiki
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Bolton, B., 2000:
 HOLOTYPE WORKER. TL 3.6, HL 1.01, HW 0.93, CI 93, ML 0.48, MI 47, SL 0.63, SI 67, PW 0.42, AL 0.86. With the above characters and the following. Outer margins of mandibles shallowly convex in full-face view. Upper scrobe margin bordered by a conspicuous laminate rim or flange throughout its length; eyes partially visible in full-face view. Leading edge of scape with a row of slender hairs which are slightly flattened or spoon-shaped apically. Cephalic dorsum clothed with inconspicuous small curved spatulate to narrowly spoon-shaped ground-pilosity; the upper scrobe margin fringed with hairs which are similar in shape and size as those on the dorsum; apicoscrobal hair absent. Cephalic dorsum with 6 simple standing hairs arranged in a transverse row close to the occipital margin; many paratypes have a more anteriorly situated pair near the highest point of the vertex. Dorsum of head reticulate-punctate, middorsum rugulose in larger specimens. Mesonotum with a single pair of stout standing hairs situated on anterior margin. Propodeum without a pair of short, fine, posteriorly curved hairs immediately anterior of propodeal spines. Ground-pilosity on alitrunk as on head but sparser. With the alitrunk in profile the posterior portion of the mesonotum sharply depressed, the metanotal groove represented by a shallow impression. Pronotal humeri rounded. Dorsolateral margin of posterior pronotum bluntly marginate. Anterior mesonotum with a distinct narrow carina above the mesothoracic spiracle. Propodeal spine long and slender, recurved, especially near the apex; propodeal lamella absent. Alitrunk dorsum reticulate-punctate; lateral margins of pronotum rugulose; pleurae more or less smooth centrally with peripheral reticulate-punctate sculpture. Petiole node in dorsal view finely reticulate-punctate, exposed area of cuticle slightly broader than long. Postpetiole superficially reticulate-punctate. Spongiform appendages of petiole weakly developed, with a narrow ventral curtain. Postpetiole with small but distinct lateral and ventral spongiform lobes. Basigastral costulae short and distinct; gaster smooth and shiny when clean. Dorsal surfaces of petiole, postpetiole, and gaster with stout standing hairs which are swollen apically. Colour dull yellow to light medium brown.
 PARATYPE WORKERS. TL 3.6 - 4.2, HL 1.00 - 1.17, HW 0.91 - 1.11, CI 90 - 95, ML 0.48 - 0.55, MI 46 - 49, SL 0.62 - 0.70, SI 63 - 68, PW 0.41 - 0.49, AL 0.81 - 1.02 (9 measured). As holotype.
 Holotype worker, Madagascar: 9.2 km. WSW Befingotra, Res. Anjanaharibe-Sud, 14 ° 45 ' S, 49 ° 28 ' E, 1200 m., 9. xi. l 994, sifted litter (leaf mold rotten wood), montane rainforest # 1192 (12) - 14 (B. L. Fisher) (MCZ). Paratypes. 9 workers and 2 queens (dealate) with same data as holotype but coded (3) - 9, (23) - 9, (24) - 9, (24) - 10, (29) - 8, (36) - 9, (40) - 4, (50) - 10, (L. O.) - IO (BMNH, SAM).
 NON-PARATYPIC MATERIAL EXAMINED. Madagascar: R. S. Manongarivo, 10.8 km. 229 ° SW Antanambao, 400 m. (B. L. Fisher); R. S. Manongarivo, 12.8 km. 228 ° SW Antanambao, 780 m. (B. L. Fisher); R. S. Manongarivo, 14.5 km. 220 ° SW Antanambao, 1175 m. (B. L. Fisher); 9.2 km. WSW Befingotra, Res. Anjanaharibe-Sud, 1280 m. (B. L. Fisher); RNI Marojejy, 375 m., 665 m. (G. D. Alpert); 55 km. S Antalaha, Nosy Ngontsy, 1 m. (Alpert ei al.); 19 km. ESE Maroantsetra, 350 m. (P. S. Ward); 5.3 km. SSE Ambanizana, Andranobe, 425 m. (B. L. Fisher); 6.9 km. NE Ambanizana, 825 m. (B. L. Fisher); Nosy Mangabe, 20 m. (P. S. Ward); S. F. Tampolo, 10 m. (B. L. Fisher); Causse de Kelifely (A. Peyrieras); Route d'Andriamena (A. Peyrieras); Foret d'Andranobe, Road to Andriamena 1200 m. (J. - M. Betsch); F. C. Sandranantitra 450 m. (H. J. Ratsirarson); F. C. Didy 960 m. (H. J. Ratsirarson); F. C. Andrianantantely 530 m. (H. J. Ratsirarson); P. N. Mantadia 895 m. (H. J. Ratsirarson); Perinet (W. L. Brown); Andasibe, 870 m. (Alpert et al.); For. d'Ambatofitorahana 293 - 294 km. on route national no. 7, 1800 m. (J. - M. Betsch); 3 km. W Ranomafana, 950 m. (P. S. Ward); Ranomafana Nat. Park, Maharira Forest, 1130 m. (E. Rajeriarison); Ranomafana Nat. Park Andranobe, Vohiparara Forest, 1160 m. (E. Rajeriarison); 45 km. S Ambalavao, 785 m. (B. L. Fisher); 11 km. NW Enakara, Res. Andohahela, 800 m. (B. L. Fisher).
 The non-paratypic material shows greater size variation than the type-series alone: HL 0.86 - 1.09, HW 0.75 - 1.04, CI 87 - 95, ML 0.41 - 0.52, MI 42 - 50, SL 0.53 - 0.68, SI 61 - 75 (12 measured), but otherwise matches all diagnostic characters.
 S. dicomas is widely distributed but easily recognized. In the Malagasy region it is the only species with mandible shape and dentition as described in the diagnosis above.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

HOLOTYPE WORKER. TL 3.6, HL 1.01, HW 0.93, CI 93, ML 0.48, MI 47, SL 0.63, SI 67, PW 0.42, AL 0.86. With the above characters and the following. Outer margins of mandibles shallowly convex in full-face view. Upper scrobe margin bordered by a conspicuous laminate rim or flange throughout its length; eyes partially visible in full-face view. Leading edge of scape with a row of slender hairs which are slightly flattened or spoon-shaped apically. Cephalic dorsum clothed with inconspicuous small curved spatulate to narrowly spoon-shaped ground-pilosity; the upper scrobe margin fringed with hairs which are similar in shape and size as those on the dorsum; apicoscrobal hair absent. Cephalic dorsum with 6 simple standing hairs arranged in a transverse row close to the occipital margin; many paratypes have a more anteriorly situated pair near the highest point of the vertex. Dorsum of head reticulate-punctate, middorsum rugulose in larger specimens. Mesonotum with a single pair of stout standing hairs situated on anterior margin. Propodeum without a pair of short, fine, posteriorly curved hairs immediately anterior of propodeal spines. Ground-pilosity on alitrunk as on head but sparser. With the alitrunk in profile the posterior portion of the mesonotum sharply depressed, the metanotal groove represented by a shallow impression. Pronotal humeri rounded. Dorsolateral margin of posterior pronotum bluntly marginate. Anterior mesonotum with a distinct narrow carina above the mesothoracic spiracle. Propodeal spine long and slender, recurved, especially near the apex; propodeal lamella absent. Alitrunk dorsum reticulate-punctate; lateral margins of pronotum rugulose; pleurae more or less smooth centrally with peripheral reticulate-punctate sculpture. Petiole node in dorsal view finely reticulate-punctate, exposed area of cuticle slightly broader than long. Postpetiole superficially reticulate-punctate. Spongiform appendages of petiole weakly developed, with a narrow ventral curtain. Postpetiole with small but distinct lateral and ventral spongiform lobes. Basigastral costulae short and distinct; gaster smooth and shiny when clean. Dorsal surfaces of petiole, postpetiole, and gaster with stout standing hairs which are swollen apically. Colour dull yellow to light medium brown.

 

PARATYPE WORKERS. TL 3.6 - 4.2, HL 1.00 - 1.17, HW 0.91 - 1.11, CI 90 - 95, ML 0.48 - 0.55, MI 46 - 49, SL 0.62 - 0.70, SI 63 - 68, PW 0.41 - 0.49, AL 0.81 - 1.02 (9 measured). As holotype.

 

Holotype worker, Madagascar: 9.2 km. WSW Befingotra, Res. Anjanaharibe-Sud, 14 ° 45 ' S, 49 ° 28 ' E, 1200 m., 9. xi. l 994, sifted litter (leaf mold rotten wood), montane rainforest # 1192 (12) - 14 (B. L. Fisher) (MCZ). Paratypes. 9 workers and 2 queens (dealate) with same data as holotype but coded (3) - 9, (23) - 9, (24) - 9, (24) - 10, (29) - 8, (36) - 9, (40) - 4, (50) - 10, (L. O.) - IO (BMNH, SAM).

 

NON-PARATYPIC MATERIAL EXAMINED. Madagascar: R. S. Manongarivo, 10.8 km. 229 ° SW Antanambao, 400 m. (B. L. Fisher); R. S. Manongarivo, 12.8 km. 228 ° SW Antanambao, 780 m. (B. L. Fisher); R. S. Manongarivo, 14.5 km. 220 ° SW Antanambao, 1175 m. (B. L. Fisher); 9.2 km. WSW Befingotra, Res. Anjanaharibe-Sud, 1280 m. (B. L. Fisher); RNI Marojejy, 375 m., 665 m. (G. D. Alpert); 55 km. S Antalaha, Nosy Ngontsy, 1 m. (Alpert ei al.); 19 km. ESE Maroantsetra, 350 m. (P. S. Ward); 5.3 km. SSE Ambanizana, Andranobe, 425 m. (B. L. Fisher); 6.9 km. NE Ambanizana, 825 m. (B. L. Fisher); Nosy Mangabe, 20 m. (P. S. Ward); S. F. Tampolo, 10 m. (B. L. Fisher); Causse de Kelifely (A. Peyrieras); Route d'Andriamena (A. Peyrieras); Foret d'Andranobe, Road to Andriamena 1200 m. (J. - M. Betsch); F. C. Sandranantitra 450 m. (H. J. Ratsirarson); F. C. Didy 960 m. (H. J. Ratsirarson); F. C. Andrianantantely 530 m. (H. J. Ratsirarson); P. N. Mantadia 895 m. (H. J. Ratsirarson); Perinet (W. L. Brown); Andasibe, 870 m. (Alpert et al.); For. d'Ambatofitorahana 293 - 294 km. on route national no. 7, 1800 m. (J. - M. Betsch); 3 km. W Ranomafana, 950 m. (P. S. Ward); Ranomafana Nat. Park, Maharira Forest, 1130 m. (E. Rajeriarison); Ranomafana Nat. Park Andranobe, Vohiparara Forest, 1160 m. (E. Rajeriarison); 45 km. S Ambalavao, 785 m. (B. L. Fisher); 11 km. NW Enakara, Res. Andohahela, 800 m. (B. L. Fisher).

 

The non-paratypic material shows greater size variation than the type-series alone: HL 0.86 - 1.09, HW 0.75 - 1.04, CI 87 - 95, ML 0.41 - 0.52, MI 42 - 50, SL 0.53 - 0.68, SI 61 - 75 (12 measured), but otherwise matches all diagnostic characters.

 

S. dicomas is widely distributed but easily recognized. In the Malagasy region it is the only species with mandible shape and dentition as described in the diagnosis above.

License not applicable

Bolton, B.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Strumigenys dicomas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATACTTTATCCTAGCAATCTGATCCGGAATAATTGGATCTTCAATAAGTATAATTATTCGCTTAGAATTAGGAACTTGCGGATCCTTAATTAATAATGATCAAATTTATAACTCCTTAATTACTAGACATGCCTTAATTATAATTTTTTTTATAATTATACCTTTTATAATTGGAGGTTTTGGTAATTTCTTAATCCCATTAATACTTGGGGCACCAGATATAGCATATCCACGTATAAATAATATAAGATTTTGATTATTACCCCCTTCACTAATATTATTACTCAGAGGAAATTTTATTGGAGAAGGTGTAGGAACTGGATGAACTATTTATCCGCCTCTATCTTCAAATATCTTTCATAATGGCCCATCAATTGATCTATCAATCTTTTCTCTTCATATTGCAGGTATATCTTCAATTTTAGGTGCTATCAACTTTATCTCAACAATTATTAATATAAAAAATATTAAAGTATCTTCAGATAAAATTCCTTTATTAATTTGATCAATTAATATTACTGCAATTTTACTGTTACTTTCACTACCTGTTTTAGCAGGAGCAATCACAATATTATTTACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGGAGGAGGGGGAGATCCTATTTTATTTCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Strumigenys dicomas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!