Overview

Brief Summary

Biology

Adult giant clams are completely sessile, unable to move from their position on the coral reef. They reproduce by expelling sperm and eggs into the sea (6), where fertilization occurs. The fertilised eggs quickly enter a swimming stage, (where they are known as trochophores), before entering a planktonic stage (7). During this stage, the larvae, (known as 'veligers'), inhabit the open ocean for one week, before settling in the substrate. If a clam is disturbed it will close its shell valves (6). Giant clams have an inhalant siphon, which they use to draw in seawater that is then filtered for planktonic food (6). The majority of the clam's nutrients however, are obtained by a mutually beneficial relationship with minute algae known as zooxanthellae (6). These plant-like algae exist in delicate tubules which are extensions of the stomach (8). The algae gain protection from predation by being associated with such a large organism, while the clam obtains the carbon by-products of photosynthesis (9). Giant clams also provide protection for a species of pea crab (Xanthasia murigera); a single pair will often be found living within the cavity of the clam (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This enormous shellfish is the largest species of bivalve mollusc in the fossil record, and the heaviest of all the living molluscs (4). Like all bivalve molluscs, the shell consists of two valves, although in the larger giant clams these cannot close completely (6). The shell is extremely thick and lacks bony plates; when viewed from above, each valve has four to five inward facing triangular projections (6). The mantle of the clam is visible between the two shells, and is a golden brown, yellow or green, although there may be such an abundance of small blue-green circles that the overwhelming impression is of a beautiful iridescent colour (6) (7). A number of pale or clear spots on the mantle, known as 'windows', allow sunlight to filter in through the mantle (6). The mantle is completely fused with the exception of two holes (or 'siphons'). The gills are visible through the inhalant siphon, while the exhalent siphon is tube-like and is capable of expelling a large volume of water during spawning or if the clam's shells close suddenly (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Madagascar, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Giant clams are found throughout the Tropical Indo-Pacific oceanic region, from the south China seas in the north to the northern coasts of Australia and from the Nicobar Islands in the west to Fiji in the east.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in shallow waters of the Pacific Ocean, from Thailand and Japan to Australia and Micronesia (1). However, the giant clam's range has reduced since the 1970s due to over-harvesting (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This is the largest living bivalve mollusk. The shell may reach up to 1.5 meters in length. They are characterized by having 4 to 5 large, inward facing triangular projections of the shell aperture, thick, heavy shells without scutes (juveniles may have some scutes), and an inhalent siphon with no tentacles. The mantle is usually golden brown, yellow, or green, with many irridescent blue, purple, or green spots, especially around the mantle edges. Larger individuals may have so many of these spots that the mantle appears solid blue or purple. Giant clams also have many pale or clear spots on the mantle, referred to as 'windows'. Giant clams cannot completely close their shell once fully grown.

Range mass: 0 to 0 kg.

Average mass: 200 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Giant clams occupy coral reef habitats, typically within 20 meters of the surface. They are most common found in shallow lagoons and reef flats, and are typically embedded in sandy substrates or those composed of coral rubble.

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 1.5 - 9
  Temperature range (°C): 26.645 - 29.241
  Nitrate (umol/L): 0.047 - 0.806
  Salinity (PPS): 33.706 - 35.216
  Oxygen (ml/l): 4.502 - 4.692
  Phosphate (umol/l): 0.089 - 0.165
  Silicate (umol/l): 1.217 - 3.088

Graphical representation

Depth range (m): 1.5 - 9

Temperature range (°C): 26.645 - 29.241

Nitrate (umol/L): 0.047 - 0.806

Salinity (PPS): 33.706 - 35.216

Oxygen (ml/l): 4.502 - 4.692

Phosphate (umol/l): 0.089 - 0.165

Silicate (umol/l): 1.217 - 3.088
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The giant clam inhabits warm tropical waters on reef flats and shallow lagoons to a depth of up to 20 metres (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Like the majority of other bivalve mollusks, Tridacna gigas can filter particulate food, including microscopic marine plants (phytoplankton) and animals (zooplankton), from seawater using its ctenidia ("gills"). However, it obtains the bulk of its nutrition from photosymbionts living within its tissues. These are unicellular algae (often called zooxanthellae) that are farmed by the mollusk host in much the same way that corals do. In some Tridacna gigas, the zooxanthellae have been shown to provide 90% of the carbon chains metabolized. This is an obligate association for the clam and it will die in the absence of the zooxanthellae, or if kept in the dark. The presence of 'windows' in the mantle may function to allow more light into mantle tissues to fuel zooxanthellae photosynthesis.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Giant clams reproduce sexually via broadcast spawning. They expel sperm and eggs into the sea. Fertilization takes place in open water and is followed by a planktonic larval stage. The larvae (veligers) must swim and feed in the water column until they are sufficiently developed to settle on a suitable substrate, usually sand or coral rubble, and begin their adult life as a sessile clam.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tridacna gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGAGTGATAATTCGAACAGAATTAGCATGGCCTGCTTCATGGCTGCAGAAT---AATAGACTTTATAATGTAATTGTTACTACACATGCATTAATTATAATTTTTTTTATGGTAATGCCGGTAATAATAGGCGGATTTGGAAACTGACTTGTACCCTTAATAATGGTA---ATACCAGATATGCATTTCCCTCGATTAAATAACTTGAGGTTTTGGTTTGTTCCTAATGCATCTTTTTTGTTAGGAGTATCTGGATTTGTAGAAGGAGGCATGGGTGCTGGTTGAACAATCTACCCCCCGCTGACTTCAATCGATTTCTTAAGAGACCCGTCTATAGATCTT---GCTATTTTTTCCCTTCACTTAGGCGGTGCCTCATCTATTGCAGCCAGGTTAAATTTTGCAAGGACTGTGGCTAATATACGACATCAAAAACGTGGCTTCCATAAGATTCCTATGTTTCCAGTGTCACTAGGTATTACAGCGTCGCTTCTTATTGTGGCAATGCCTGTGTTAGCTGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tridacna gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Wells, S.

Reviewer/s

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1983
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Giant clams are listed as vulnerable by the IUCN because of extensive collecting for food, aquaculture, and the aquarium trade. Numbers in the wild have been greatly reduced.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Giant clams have been extensively harvested for their meat and to supply the aquarium trade with such exotic specimens (6). Unable to sustain this exploitation, populations are now showing signs of decline; Tridacna gigas have not been seen in Fiji for over 50 years, primarily as a result of past over-collection for food (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

These clams are listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), which requires a permit to be granted before clams can be exported (3). There has been considerable success with farming (10), which may help to alleviate the pressure on wild populations in the long-term. Farmed clams may also be used in restocking programmes, where numbers have become severely restricted in the wild. Giant clams were reintroduced to Tongan waters in 1990 (2), from quarantined-reared stocks cultured in Australia under the Australian Centre for International Agricultural Research and James Cook University giant clam project (11). These enormous molluscs have inspired awe for centuries and effective protection measures are vital if they are to be adequately conserved for future generations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Despite their classic movie depictions as "killer clams," there are no authentic cases of people being trapped and drowned by giant clams. Tridacnids are actually quite lethargic and slow about closing. Tridacnid-associated injuries are quite common however. They typically involve hernias, back injuries, and smashed toes induced when people lift adult clams out of the water unaware of their formidable weight in air.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tridacnids are integral and colorful members of the Indo-Pacific coral reef ecosystems. All eight species of giant clams are currently being cultured. Tridacnid aquaculture ventures have diverse aims that include conservation and restocking programs. Farmed giant clams are also sold for food (the adductor muscle is considered a delicacy) and for the aquarium trade.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Giant clam

The name is also used for other gigantic clam species. See Tridacnidae.

The giant clam, Tridacna gigas (known as pā’ua in Cook Islands Māori), is the largest living bivalve mollusk. T. gigas is one of the most endangered clam species. Antonio Pigafetta documented these in his journal as early as 1521. One of a number of large clam species native to the shallow coral reefs of the South Pacific and Indian oceans, they can weigh more than 200 kilograms (440 lb), measure as much as 120 cm (47 in) across, and have an average lifespan in the wild of 100 years or more.[2] They are also found off the shores of the Philippines, where they are called taklobo, and in the South China Sea in the coral reefs of Sabah (Malaysian Borneo). T. gigas lives in flat coral sand or broken coral and can be found at depth of as much as 20 m (66 ft).[3] Its range covers the Indo-Pacific, but populations are diminishing quickly and the giant clam has become extinct in many areas where it was once common. T. maxima has the largest geographical distribution among giant clam species; it can be found in high- or low-islands, lagoons, or fringing reefs.[4] Its rapid growth rate is likely due to its ability to cultivate algae in its body tissue.[3]

Although larval clams are planktonic, they become sessile in adulthood. The creature's mantle tissues act as a habitat for the symbiotic single-celled dinoflagellate algae (zooxanthellae) from which it gets nutrition. By day, the clam opens its shell and extends its mantle tissue so that the algae receive the sunlight they need to photosynthesize.

Contents

Anatomy

Young T. gigas are difficult to distinguish from other species of Tridacnidae. Adult T. gigas are the only giant clams unable to close their shells completely. Even when closed, part of the mantle is visible, unlike the very similar T. derasa. However, this can only be recognized with increasing age and growth. Small gaps always remain between shells through which retracted brownish-yellow mantle can be seen.[5]

T. gigas has four or five vertical folds in its shell; this is the main characteristic that separates it from the very similar shell of T. derasa, which has six or seven vertical folds.[5] As with massive deposition of coral matrices composed of calcium carbonate, the bivalves containing zooxanthellae have a tendency to grow massive calcium carbonate shells.[6] The mantle's edges are packed with symbiotic zooxanthellae that presumably utilize carbon dioxide, phosphates, and nitrates supplied by the clam.[7]

Largest specimens

The largest known T. gigas specimen measured 137 centimetres (4.49 ft). It was discovered around 1817 on the north western coast of Sumatra. The weight of the two shells was 230 kilograms (510 lb). This suggests that the live weight of the animal would have been roughly 250 kilograms (550 lb). Today these shells are on display in a museum in Northern Ireland.[8]

Another unusually large giant clam was found in 1956 off the Japanese island of Ishigaki. However, it was not examined scientifically before 1984. The shell's length was 115 centimetres (3.77 ft) and the weight of the shells and soft parts was 333 kilograms (730 lb). Scientists estimated the live weight to be around 340 kilograms (750 lb).[8]

Ecology

Feeding

Algae provide giant clams with a supplementary source of nutrition.[7] These plants consist of unicellular algae, whose metabolic products add to the clam's filter food.[3] As a result, they are able to grow as large as 100 cm length even in nutrient-poor coral-reef waters.[7] The clams cultivate algae in a special circulatory system which enables them to keep a substantially higher number of symbionts per unit of volume.[9][10]

In small clams—10 milligrams (0.010 g) dry tissue weight—filter feeding provides about 65% of total carbon needed for respiration and growth; large clams (10 g) acquire only 34% of carbon from this source.[11] A single species of zooxenthellae may be symbionts of both giant clams and nearby reef–building (hermatypic) corals.[7]

Reproduction

T. gigas reproduce sexually and are hermaphrodites (producing both eggs and sperm). Self-fertilization is not possible, but this characteristic does allow them to reproduce with any other member of the species. This reduces the burden of finding a compatible mate, while simultaneously doubling the number of offspring produced by the process. As with all other forms of sexual reproduction, hermaphroditism ensures that new gene combinations are passed to further generations.[12]

Since giant clams cannot move themselves, they adopt broadcast spawning. They release sperm and eggs into the water. A transmitter substance called Spawning Induced Substance (SIS) helps synchronize the release of sperm and eggs to ensure fertilization. The substance is released through a syphonal outlet. Other clams can detect SIS immediately. Incoming water passes chemoreceptors situated close to the inccurent syphon, which transmit the information directly to the cerebral ganglia, a simple form of brain.[13]

Detection of SIS stimulates the giant clam to swell its mantle in the central region and to contract its adductor muscle. Each clam then fills its water chambers and closes the incurrent syphon. The shell contracts vigorously with the adductor's help, so the excurrent chamber's contents flows through the excurrent syphon. After a few contractions containing only water, eggs and sperm appear in the excurrent chamber and then pass through the excurrent syphon into the water. Female eggs have a diameter of 100 micrometres (0.0039 in). Egg release initiates the reproductive process. An adult T. gigas can release more than 500 million eggs at a time.[14]

Richard D. Braley of the University of New South Wales School of Zoology observed that spawning seems to coincide with incoming tides near the second (full), third, and fourth (new) quarters of the moon phase. Spawning contractions occurred every 2–3 minutes, with intense spawning ranging from thirty minutes to two and a half hours. Braley also hypothesized that clams that do not respond to the spawning of neighbor clams may be reproductively inactive.[15]

Development

The fertilized egg floats in the sea for about 12 hours until eventually a larva (trocophore) hatches. It then starts to produce a calcium carbonate shell. Two days after fertilization it measures 160 micrometres (0.0063 in). Soon it develops a “foot,” which is used to move on the ground; it can also swim to search for appropriate habitat.[16]

At roughly one week of age, the clam settles on the ground, although it changes location frequently within the first few weeks. The larva does not yet have symbiotic algae, so it depends completely on plankton. Free floating zooxanthellae are also captured while filtering food. Eventually the front adductor muscle disappears and the rear muscle moves into the clam's center. Many small clams die at this stage. The clam is considered a juvenile when it reaches a length of 20 cm .[17] It is difficult to observe the growth rate of T. gigas in the wild, but laboratory-reared giant clams have been observed to grow 12 cm a year.[18]

Human relevance

The main reason that giant clams are becoming endangered is likely to be intensive exploitation by bivalve fishing vessels. Mainly large adults are killed since they are the most profitable.[19]

The giant clam is considered a delicacy in Japan (known as Himejako), France, South East Asia and many Pacific Islands. Some Asian foods include the meat from the muscles of clam. On the black market, giant clam shells are sold as decorative accoutrements. At times large amounts of money were paid for the adductor muscle, which Chinese people believed have aphrodisiac powers.[20] A team of American and Italian researchers analyzed bivalves and found they were rich in amino acids that trigger increased levels of sex hormones.[21] Their high zinc content aids the production of testosterone.[22]

Legend

As is often the case with uncharacteristically large species, the giant clam has been historically misunderstood. It was known in times past as the killer clam or man-eating clam, and reputable scientific and technical manuals once claimed that the great mollusc had caused deaths; versions of the U.S. Navy Diving Manual even gave detailed instructions for releasing oneself from its grasp by severing the adductor muscles used to close its shell.

In an account of the discovery of the Pearl of Lao Tzu, Wilburn Cobb said he was told that a Dyak diver was drowned when the Tridacna closed its shell on his arm.[23]

Today the giant clam is considered neither aggressive nor particularly dangerous. While it is certainly capable of gripping a person, the shell's closing action is defensive, not aggressive and the shell valves close too slowly to pose a serious threat.[citation needed] Furthermore, many large individuals are unable to completely close their shells.

Aquaculture

Mass culture of giant clams began at the Micronesian Mariculture Demonstration Center in Palau (belau).[24] A large Australian government-funded project from 1985–1992 mass cultured giant clams, particularly T. gigas at James Cook University's Orpheus Island Research Station, and supported the development of hatcheries in the Pacific Islands and the Philippines.[25][26][27] Recent developments in aquaculture, specifically at Harbor Branch Oceanographic Institute in Ft. Pierce, Florida, and in the Marshall Islands, have succeeded in tank-raising T. gigas both for use in home aquariums and for release into the wild.

Seven of the ten known species of giant clams in the world are found in the coral reefs of the South China Sea. A programme to propagate endangered giant clams for release into the wild has been ongoing since 2007. Undertaken by the Marine Ecology Research Centre (www.merc-gayana.com) based in Gaya Island just west of Sabah’s capital, Kota Kinabalu, the programme successfully nurtured all seven species of the giant clams found in Malaysian waters to sufficient maturity for them to be placed in an ocean nursery for the first time during an Awareness Month happening from the 22nd of March till the 22 of April 2012 in Maloham Bay. This Marine Awareness month March 2012 – April 2012 had been planned to highlight and celebrate MERC's success in raising the giant clam larvae (called spats) to juvenile stage, to highlight the importance of the giant clams and to raise awareness and support with the general public on the threats that are faced by the giant clams within the sea. During this Marine Awareness Month, the coral restoration program will enter its final stage and attachment of 1000 one year old coral fragments grown at MERC's ocean nursery onto the coral reef would be done throughout the month. The coral restoration program is aimed to provide the giant clams with a suitable home surroundings when they are big enough in the future to be placed onto the reef.

Conservation status

The IUCN lists the giant clams as vulnerable. There is concern among conservationists about whether those who use the species as a source of livelihood are overexploiting it. The numbers in the wild have been greatly reduced by extensive harvesting for food and the aquarium trade.

Gallery

See also

Citations

  1. ^ "World Register of Marine Species". 2009. Retrieved 15 March 2010. 
  2. ^ "Giant Clam: Tridacna gigas". National Geographic Society. Retrieved 2007-06-02. 
  3. ^ a b c Knop, p. 10.
  4. ^ Munro, p. 99.
  5. ^ a b Knop, p. 32.
  6. ^ Dame, p. 51.
  7. ^ a b c d Gosling, p. 23.
  8. ^ a b Knop, p. 31.
  9. ^ Jeffrey
  10. ^ Norton
  11. ^ Klumpp
  12. ^ Knop, p. 46.
  13. ^ Knop, p. 47.
  14. ^ Knop, p. 48.
  15. ^ Braley
  16. ^ Knop, p. 49.
  17. ^ Knop, p. 53.
  18. ^ Beckvar
  19. ^ Knop, p. 33.
  20. ^ Knop, p. 11.
  21. ^ "Pearly wisdom: oysters are an aphrodisiac". The Sydney Morning Herald. 2005-03-24. 
  22. ^ Kurlansky, Mark (2006). The Big Oyster: History on the Half Shell. Penguin Group. p. 160. ISBN 0-345-47638-7. 
  23. ^ Accounts by Wilburn Dowell Cobb
  24. ^ Heslinga, Gerald A.; Perron, Frank E.; Orak, Obichang (1984). "Mass culture of giant clams (F. Tridacnidae) in Palau". Aquaculture 39: 197. doi:10.1016/0044-8486(84)90266-7. 
  25. ^ Copland, J.W. and J.S. lucas (Eds.) 1988. Giant Clams in Asia and the Pacific. ACIAR Monograph No. 9
  26. ^ Braley, R.D. (1988). "Farming the Giant Clam". World Aquaculture 20 (1): 7–17. 
  27. ^ Fitt W.K (Ed.) 1993. Biology and Mariculture of Giant Clams; a workshop held in conjunction with the 7th International Coral Reef Symposium, 21–26 June 1992, Guam, USA

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!