Overview

Brief Summary

Biology

Adult giant clams are completely sessile, unable to move from their position on the coral reef. They reproduce by expelling sperm and eggs into the sea (6), where fertilization occurs. The fertilised eggs quickly enter a swimming stage, (where they are known as trochophores), before entering a planktonic stage (7). During this stage, the larvae, (known as 'veligers'), inhabit the open ocean for one week, before settling in the substrate. If a clam is disturbed it will close its shell valves (6). Giant clams have an inhalant siphon, which they use to draw in seawater that is then filtered for planktonic food (6). The majority of the clam's nutrients however, are obtained by a mutually beneficial relationship with minute algae known as zooxanthellae (6). These plant-like algae exist in delicate tubules which are extensions of the stomach (8). The algae gain protection from predation by being associated with such a large organism, while the clam obtains the carbon by-products of photosynthesis (9). Giant clams also provide protection for a species of pea crab (Xanthasia murigera); a single pair will often be found living within the cavity of the clam (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This enormous shellfish is the largest species of bivalve mollusc in the fossil record, and the heaviest of all the living molluscs (4). Like all bivalve molluscs, the shell consists of two valves, although in the larger giant clams these cannot close completely (6). The shell is extremely thick and lacks bony plates; when viewed from above, each valve has four to five inward facing triangular projections (6). The mantle of the clam is visible between the two shells, and is a golden brown, yellow or green, although there may be such an abundance of small blue-green circles that the overwhelming impression is of a beautiful iridescent colour (6) (7). A number of pale or clear spots on the mantle, known as 'windows', allow sunlight to filter in through the mantle (6). The mantle is completely fused with the exception of two holes (or 'siphons'). The gills are visible through the inhalant siphon, while the exhalent siphon is tube-like and is capable of expelling a large volume of water during spawning or if the clam's shells close suddenly (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Giant clams are found throughout the Tropical Indo-Pacific oceanic region, from the south China seas in the north to the northern coasts of Australia and from the Nicobar Islands in the west to Fiji in the east.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found in shallow waters of the Pacific Ocean, from Thailand and Japan to Australia and Micronesia (1). However, the giant clam's range has reduced since the 1970s due to over-harvesting (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

This is the largest living bivalve mollusk. The shell may reach up to 1.5 meters in length. They are characterized by having 4 to 5 large, inward facing triangular projections of the shell aperture, thick, heavy shells without scutes (juveniles may have some scutes), and an inhalent siphon with no tentacles. The mantle is usually golden brown, yellow, or green, with many irridescent blue, purple, or green spots, especially around the mantle edges. Larger individuals may have so many of these spots that the mantle appears solid blue or purple. Giant clams also have many pale or clear spots on the mantle, referred to as 'windows'. Giant clams cannot completely close their shell once fully grown.

Range mass: 0 to 0 kg.

Average mass: 200 kg.

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Giant clams occupy coral reef habitats, typically within 20 meters of the surface. They are most common found in shallow lagoons and reef flats, and are typically embedded in sandy substrates or those composed of coral rubble.

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 1.5 - 9
  Temperature range (°C): 26.645 - 29.241
  Nitrate (umol/L): 0.047 - 0.806
  Salinity (PPS): 33.706 - 35.216
  Oxygen (ml/l): 4.502 - 4.692
  Phosphate (umol/l): 0.089 - 0.165
  Silicate (umol/l): 1.217 - 3.088

Graphical representation

Depth range (m): 1.5 - 9

Temperature range (°C): 26.645 - 29.241

Nitrate (umol/L): 0.047 - 0.806

Salinity (PPS): 33.706 - 35.216

Oxygen (ml/l): 4.502 - 4.692

Phosphate (umol/l): 0.089 - 0.165

Silicate (umol/l): 1.217 - 3.088
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The giant clam inhabits warm tropical waters on reef flats and shallow lagoons to a depth of up to 20 metres (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Like the majority of other bivalve mollusks, Tridacna gigas can filter particulate food, including microscopic marine plants (phytoplankton) and animals (zooplankton), from seawater using its ctenidia ("gills"). However, it obtains the bulk of its nutrition from photosymbionts living within its tissues. These are unicellular algae (often called zooxanthellae) that are farmed by the mollusk host in much the same way that corals do. In some Tridacna gigas, the zooxanthellae have been shown to provide 90% of the carbon chains metabolized. This is an obligate association for the clam and it will die in the absence of the zooxanthellae, or if kept in the dark. The presence of 'windows' in the mantle may function to allow more light into mantle tissues to fuel zooxanthellae photosynthesis.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Giant clams reproduce sexually via broadcast spawning. They expel sperm and eggs into the sea. Fertilization takes place in open water and is followed by a planktonic larval stage. The larvae (veligers) must swim and feed in the water column until they are sufficiently developed to settle on a suitable substrate, usually sand or coral rubble, and begin their adult life as a sessile clam.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tridacna gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AGAGTGATAATTCGAACAGAATTAGCATGGCCTGCTTCATGGCTGCAGAAT---AATAGACTTTATAATGTAATTGTTACTACACATGCATTAATTATAATTTTTTTTATGGTAATGCCGGTAATAATAGGCGGATTTGGAAACTGACTTGTACCCTTAATAATGGTA---ATACCAGATATGCATTTCCCTCGATTAAATAACTTGAGGTTTTGGTTTGTTCCTAATGCATCTTTTTTGTTAGGAGTATCTGGATTTGTAGAAGGAGGCATGGGTGCTGGTTGAACAATCTACCCCCCGCTGACTTCAATCGATTTCTTAAGAGACCCGTCTATAGATCTT---GCTATTTTTTCCCTTCACTTAGGCGGTGCCTCATCTATTGCAGCCAGGTTAAATTTTGCAAGGACTGTGGCTAATATACGACATCAAAAACGTGGCTTCCATAAGATTCCTATGTTTCCAGTGTCACTAGGTATTACAGCGTCGCTTCTTATTGTGGCAATGCCTGTGTTAGCTGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tridacna gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Giant clams are listed as vulnerable by the IUCN because of extensive collecting for food, aquaculture, and the aquarium trade. Numbers in the wild have been greatly reduced.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Wells, S.

Reviewer/s

Contributor/s

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Giant clams have been extensively harvested for their meat and to supply the aquarium trade with such exotic specimens (6). Unable to sustain this exploitation, populations are now showing signs of decline; Tridacna gigas have not been seen in Fiji for over 50 years, primarily as a result of past over-collection for food (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

These clams are listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), which requires a permit to be granted before clams can be exported (3). There has been considerable success with farming (10), which may help to alleviate the pressure on wild populations in the long-term. Farmed clams may also be used in restocking programmes, where numbers have become severely restricted in the wild. Giant clams were reintroduced to Tongan waters in 1990 (2), from quarantined-reared stocks cultured in Australia under the Australian Centre for International Agricultural Research and James Cook University giant clam project (11). These enormous molluscs have inspired awe for centuries and effective protection measures are vital if they are to be adequately conserved for future generations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Despite their classic movie depictions as "killer clams," there are no authentic cases of people being trapped and drowned by giant clams. Tridacnids are actually quite lethargic and slow about closing. Tridacnid-associated injuries are quite common however. They typically involve hernias, back injuries, and smashed toes induced when people lift adult clams out of the water unaware of their formidable weight in air.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tridacnids are integral and colorful members of the Indo-Pacific coral reef ecosystems. All eight species of giant clams are currently being cultured. Tridacnid aquaculture ventures have diverse aims that include conservation and restocking programs. Farmed giant clams are also sold for food (the adductor muscle is considered a delicacy) and for the aquarium trade.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!