Overview

Brief Summary

A number of Trichinella nematode (roundworm) species infect humans and cause trichinellosis (trichinosis). In addition to the classical agent T. spiralis (found worldwide in many carnivorous and omnivorous animals), several other species of Trichinella are now recognized, including T. pseudospiralis (from mammals and birds worldwide), T. nativa (from Arctic bears and walruses), T. nelsoni (from African predators and scavengers), T. britovi (from carnivores, pigs, and horses of temperate Europe and western Asia and northern and western Africa ), T. murelli (from bears and horses in North America), and T. papuae (from wild and domestic pigs and saltwater crocodiles in Papua New Guinea and Thailand). Trichinella zimbabwensis is found in crocodiles and monitor lizards in Africa but there are no known associations of this species with human disease.

Trichinellosis occurs worldwide, but is most common in parts of Europe and the United States. Adult worms and encysted larvae develop within a single vertebrate host and an infected animal serves as a definitive host and potential intermediate host. A second host is required to perpetuate the life cycle. The domestic cycle most often involved pigs and anthropophilic rodents, but other domestic animals such as horses can be involved. In the sylvatic cycle, the range of infected animals is great, but animals most often associated as sources of human infection are bear, moose, and wild boar.

Trichinellosis is caused by the ingestion of undercooked meat containing encysted larvae (except for T. pseudospiralis and T. papuae, which do not encyst) of Trichinella species. After exposure to gastric acid and pepsin, the larvae are released from the cysts and invade the small bowel mucosa where they develop into adult worms. Females are 2.2 mm in length; males 1.2 mm. The life span in the small bowel is about four weeks. After 1 week, the females release larvae that migrate to striated muscles, where they encyst. Diagnosis is usually made based on clinical symptoms and is confirmed by serology or identification of encysted or non-encysted larvae in biopsy or autopsy specimens.

Gottstein et al. (2009) reviewed the epidemiology, diagnosis, treatment, and control of trichinellosis.

(Centers for Disease Control Parasites and Health website; Gottstein et al. 2009)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Trichinella spiralis is prevalent in Mexico, the northern hemisphere, parts of southern Asia, Africa, South America, and the Middle East. The species is also found in other tropical regions.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical

  • Olsen, O. 1974. Animal Parasties: Their Life Cycles and Ecology. University Park Press.
  • Roberts, L., J. Janvoy. 1996. Foundations of Parasitology, 6th edt.. The McGraw-Hill Companies, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Trichinella spiralis is the smallest known nematode parasite of humans. The males measure about 1.4 mm to 1.6 mm in length and the females are twice the size of the males. The body of the worm is more slender at the anterior then at the posterior end. In females the uterus is contained in the posterior portion of the worm and is filled with the developing eggs. The anterior end of the female contains hatching juveniles.

This nematode has a   cuticle with three or more main outer layers made of collagen and other compounds. The outer layers are non-cellular and are secreted by the epidermis. The cuticle layer protects the nematodes so they can invade the digestive tracts of animals.

Nematodes have longitudinal   muscles along the body wall. The muscles are obliquely arranged in bands. Dorsal, ventral and longitudinal nerve cords are connected to the main body of the muscle.

Range length: 1.4 to 3.2 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Barnes, R. 1987. Invertebrate Zoology. Orlando, Florida: Dryden Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Trichinella spiralis has an extremely broad host range; almost any species of mammal can become infected. Adult worms live around the columnar epithelial cells of the small intestine and the larvae live in striated muscle cells of the same mammal.

There are three different ecological types of life cycles, the urban cycle, the sylvatic cycle, and the marine cycle. In the urban cycle, rats and pigs serve as hosts and reservoirs of the parasite. Humans can become infected with the worm by eating pork that is not cooked thoroughly. In the sylvatic cycle, predators and scavengers are hosts to T. spiralis. Seals, walruses, whales, and polar bears are all hosts in the marine cycle.

Habitat Regions: temperate ; tropical ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

  • Lapage, G. 1957. Parasitic Animals. Cambridge at the University Press.
  • Wassom, D. 1988. Genetic control of Immunity to Parasite Infections: Studies of Trichinella-infected Mice. Pp. 329-346 in P Englund, A Sher, eds. The Biology of Parasitism. MBL Lectures in Biology Vol. 9. New York: Alan R. Liss Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Adults feed in the intestinal epithelium of the host. The juveniles penetrate individual fibers in skeletal muscles and feed there.

Pharyngeal glands and intestinal epithelium produce digestive enzymes to feed on the hosts’ body fluids. Extracellular digestion begins within the   lumen and is finished intracellularly.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Humans tend to become infected from infected pigs, however the incidence in pigs is only 0.37% (Lukashenko, 1966). The species can be found more easily in cats with an incidence of 71.23%, rats with 6.43%, or even mice with 3.38%.

Ecosystem Impact: parasite

Species Used as Host:

  • Lukashenko, N. 1966. The Epizootology of Trichinellosis. Pp. 371-375 in A Petrov, ed. Contributions to Helminthology. Jerusalem: Israel Program for Scientific Translations Ltd..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

These parasites are usually not preyed on directly, but are ingested from host to host. Larval mortality is high as most of the parasites do not reach appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Nematodes in general have papillae,   setae and amphids as the main sense organs. Setae detect motion (mechanoreceptors), while amphids detect chemicals (chemoreceptors).

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The life cycle for this species begins after ingestion of the first stage juvenile from the intermediate host. The worm molts four times within the first thirty hours and then mates. These larvae exit through the gut wall and enter the blood system through the branches of the hepatic portal vein or through the lymphatic system. They are transported all over the body and take up residence in voluntary muscles by entering individual muscle cells. The larvae grow within the muscles and a covering is created around them causing a cyst. After the cyst is formed the worm cannot migrate any further. The only way this species can continue its life cycle is to be ingested by another host through a predator-prey interaction. When the new host eats the muscle tissue containing the cyst the digestive juices break down the capsule and release the worm.

  • Read, C. 1972. Animal Parasitism. New Jersey: Prentice-Hall, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The life cycle for this species begins after ingestion of the first stage juvenile from the intermediate host. The worm molts four times within the first thirty hours and then mates.

Females may produce a phermomone to attract males. The male   coils around a female with his curved area over the female genital pore. The gubernaculum, made of cuticle tissue, guides spicules which extend through the cloaca and anus. Males use spicules to hold the female during copulation. Nematode sperm are amoeboid-like and lack flagella.

The female is ovo-viviparous. This means that she produces eggs, but doesn't lay them until they have already hatched in her uterus. She lays her living larvae within the small intestine beginning the fifth or sixth day after infection.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Protecting: Female)

  • Barnes, R. 1987. Invertebrate Zoology. Orlando, Florida: Dryden Press.
  • Lapage, G. 1957. Parasitic Animals. Cambridge at the University Press.
  • Olsen, O. 1974. Animal Parasties: Their Life Cycles and Ecology. University Park Press.
  • Read, C. 1972. Animal Parasitism. New Jersey: Prentice-Hall, Inc..
  • Wassom, D. 1988. Genetic control of Immunity to Parasite Infections: Studies of Trichinella-infected Mice. Pp. 329-346 in P Englund, A Sher, eds. The Biology of Parasitism. MBL Lectures in Biology Vol. 9. New York: Alan R. Liss Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trichinella spiralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGATAAAATGACTCTACTCAGGAAATCACAAAAAAATCGGAACATTATACATTTTATTCGGTATCATTGGAGGAATATTAGGAATCTCCTTATCTGCTCTAATCCGAATAATCTTATCCTCACCATGGACATTTAATGTGAACGGACTAATTTCAGAATACTATAACGTAATTGTCACCGCCCACGCACTTGCTATAATCTTCTTCATAGTAATACCTATACTACTAAGAGGATTCGGAAATTGACTAATTCCAATTATAGCGGGAGCAGCTGACATATCCTTTCCACGACTAAATAATCTAGGGTTCTGATTATTACCCCCTGCTCTAATACTACTAAGCTCATCTATACTCATTAATATAGGAGCCGGAACAGGATGAACCATTTACCCTCCACTATCTACTTGACTCGGACATCCCAACCACAGTGTTGATTTAGTAATCTTCTCCCTACACTTAGCTGGCATCTCATCAATTACAGGAAGAATCAACTTCATTACCACATGTTTCCTATCGCGACCCATCATCTACACATTAGAACGATTAAGCATGTTTGTTTGAAGAGTACTAATCACATCATTTATATTAATTATTTCACTACCAGTTTTAGCAGGCGGAATTACCATACTCCTAACAGATCGTAATTTCGGCACAACTTTCTTCGAAACTTCAGGAGGAGGAGACCCCATCCTATTCCAACACATATTTTGGTTCTTCGGACACCCAGAAGTATATATTCTAGTACTACCTGCTTTCGGAGTAGTATCCGAAGCATTAATATTCATATCCGGAAAATTTAAAGTATTCGGACCACTTGGAATAATCTATGCAATAACAAGAATCGGCATCTTAGGATGTTTTGTATGAGGTCACCACATATATACAGTCGGTATAGACATCGACACACGAGCTTATTTCACCGCCGCTACAATAATTATTGGTATCCCAACCGGCGTAAAAATCTTCAGATGATTAGCTACACTATATGGTACCCACATTAAAATAACACCAGCCATATTATGAGTACTAGGATTTCTCCTATTATTCACAATAGGGGGGCTAACAGGAGTCAGACTCTCAAACGCTTCTCTAGATCTACTATTACATGATACATACTATGTAGTGGGACATTTCCACTTTGTTTTAAGCATAGGAGTAGTTTTTGCTATTATAATCGCAGTAACACTATGAACACCATGAATATTAGGATTCTCCTTCAACACAATCATCCAAAAGACCCAATTTAACCTAATATTTATTGGAGCTAACCTAACATTCATACCACAACACTTCCTAGGACTAAACGGAATACCACGTCGATATGTAGACTATAGAGACATATACTCACTTATACACACATTATCCTCATTCGGCAGTCTTCTATCTCTTAGAGCATCCCTCTTATTCCTCTTTATAATATGAGAAGCCACAGCCTCTAATCGCCAAACAATCGCTAACAATAGAATAATAACCTCACCAGAAATACTAATAAACTACCCTATAACCGAACACACCTGCATCCAAAGACCTACCCTATCCACATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trichinella spiralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Humans may know this parasite more commonly by the disease that it causes. This disease is known as trichinosis, trichiniasis, or trichinelliasis. Humans can obtain this parasite by eating meat that is already infected. Generally, a human gets the disease by eating undercooked pork. Raw sausage is a delicacy in many areas of the world, making trichinosis a chronic health problem. Symptoms of this disease may include:

  1. Weakness and muscular twitching, from the juvenile being deposited by the female worm.
  2. Edema around the eyes, intense muscular pain, disturbances in the way the muscles function, difficulty with respiration, and a consistent fever are symptoms that correspond to the juvenile's migration and penetration of muscle tissue.
  3. Face becomes puffy. The swelling of extremities, damage to the heart, nervous system and other organs, puffiness in the face, and pneumonia are symptoms that can occur with the encysting of the worms in the muscle tissue.

A good treatment for ridding the body of this parasite is not known. Treatment with analgesics and corticosteroids merely relieves the symptoms of trichinosis. The incidence of infection has steadily declined throughout the world. Cases in the United States declined from over 400 per year in the 1940's to 30-40 cases per year from 1987-1989.

Negative Impacts: injures humans (causes disease in humans ); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The research done leads to the conclusion that there is no known economic benefit to humans from Trichinella spiralis.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Trichinella spiralis

Trichinella spiralis is a nematode parasite, occurring in rats, pigs, bears and humans, and is responsible for the disease trichinosis. It is sometimes referred to as the "pork worm" due to it being found commonly in undercooked pork products.

Contents

Description [edit]

Trichinella species are the smallest nematode parasite of humans, have an unusual life cycle and are one of the most widespread and clinically important parasites in the world.[1] The small adult worms mature in the intestines of an intermediate host such as a pig. Each adult female produces batches of live larvae, which bore through the intestinal wall, enter the blood (to feed on it) and lymphatic system, and are carried to striated muscle. Once in the muscle, they encyst, or become enclosed in a capsule. Humans can be infected by eating infected pork or horse or wild carnivores such as fox, cat or bear.[1]

Morphology [edit]

Males of T. spiralis measure between 1.4 mm and 1.6 mm long and are more flat anteriorly than posteriorly. The anus can be found in the terminal (side) and they have a large copulatory pseudobursa on each side.[1] The females of T. spiralis are about twice the size of the males and have an anus found terminally. The vulva is located near the esophagus. The single uterus of the female is filled with developing eggs in the posterior portion, while the anterior portion contained the fully developed juveniles.[1]

Life cycle [edit]

Trichinella spiralis is a parasitic nematode that has a direct life cycle, meaning it completes all stages of development in one host. The larval forms are encapsulated as a small cystic structure within the infected host. Humans typically become infected when they eat improperly cooked pork or Trichinella infected meat. When a human eats the infected meat, the larvae are released from the nurse cell (due to stomach pH) and migrate to the intestine, where they burrow into the intestinal mucosa, mature, and reproduce.[2] Juveniles within nurse cells have an anaerobic or facultative anaerobic metabolism, but when they become activated, they adopt an aerobic metabolism characteristics of the adult.[1] Female Trichinella worms live for about six weeks, and in that time can produce up to 1,500 larvae; when a spent female dies, she passes out of the host. The larvae can then gain access to the circulation and migrate around the body of the host.[2] The migration and encystment of larvae can cause fever and pain brought upon by the host inflammatory response. In some cases, migration to specific organ tissues can cause myocarditis and encephalitis that can result in death.

Nurse cell formation [edit]

This nematode is a multi-celular parasite that lives within a single muscle cell, which it modifies according to its own requirements.[3]

Trichinella spiralis larvae within the diaphragm muscle of a pig

Nurse cell formation in skeletal muscle tissue is mediated by the hypoxic environment surrounding the new vessel formation.[4] The hypoxic environment stimulates cells in the surrounding tissue to regulate up and secrete angiogenic cytokines, such as VEGF. This allows for the newborn T. spiralis larvae to enter and form the nurse cells. VEGF expression is detected surrounding the nurse cell right after nurse cell formation, and the continued secretion of VEGF can maintain the constant state of hypoxia.[5] Previous studies have shown VEGF can stimulate proliferation of synthesis of collagen type 1 in activated myofibroblast-like cells.[6]

Symptoms [edit]

The first symptoms may appear between 12 hours and two days after ingestion of infected meat. The migration of worms in the intestinal epithelium can cause traumatic damage to the host tissue, and the waste products they excrete can provoke an immunological reaction.[1] The resulting inflammation can cause symptoms such as nausea, vomiting, sweating and diarrhea. Five to seven days after the appearance of symptoms, facial edema and fever may occur. After 10 days, intense muscular pain, difficulty breathing, weakening of pulse and blood pressure, heart damage and various nervous disorders may occur, eventually leading to death due to heart failure, respiratory complications or kidney malfunction.[1]

In pigs, infection is usually subclinical but large numbers of worms can be fatal in some cases.[7]

Diagnosis and treatment [edit]

Muscle biopsy is used for trichinosis detection. Several immunodiagnostic tests are also available. Typically, patients are treated with either mebendazole or albendazole, but efficacy of such products are uncertain. Symptoms can be relieved by use of analgesics and corticosteroids.[1]

In pigs, ELISA testing is possible as a method of diagnosis. Anthelmintics can treat and prevent Trichinella infections.[7]

Prevention and control [edit]

Trichinosis (also trichinellosis) is a disease caused by tissue-dwelling roundworms of the species Trichinella spiralis. In the United States, the national trichinellosis surveillance system has documented a steady decline in the reported incidence of this disease. During 1947 to 1951, a median of 393 cases was reported annually, including 57 trichinellosis-related deaths. During 1997-2001, the incidence decreased to a median of 12 cases annually, with no reported deaths. The decline of infection was largely associated with changes implemented by the U.S. pork industry that have resulted in reduced prevalence of Trichinella among domestic swine.[8] In the United States, Congress passed the Federal Swine Health Protection Act restricting the use of uncooked garbage as feed stock for pigs and creating a voluntary Trichinae Herd Certification Program.[8] The Trichinae Herd Certification Program is a voluntary preharvest pork safety program that provides documentation of swine management practices to minimize Trichinella exposure. The goal of the program is to establish a system under which pork production facilities that follow good production practices might be certified as Trichinella-safe.[9] In addition to the reduction in Trichinella prevalence in commercial pork, processing methods also have contributed to the dramatic decline in human trichinellosis associated with pork products. Through the U.S. Code of Federal Regulations, USDA has created guidelines for specific cooking temperatures and times, freezing temperatures and times, and curing methods for processed pork products to control postharvest human exposure to Trichinella.[8] Pork products meeting these guidelines are designated certified pork.

In most abattoirs, the diaphragm of pigs is routinely sampled to detect Trichinella infection.[7]

Genome [edit]

The Trichinella spiralis draft genome became available in March 2011.[10] The genome size was 58.55 Mbp with an estimated 16,549 genes.[11] It was subsequently shown that the Trichinella spiralis genome is the only known nematode genome to be subject to DNA methylation,[12] an epigenetic mechanism that was not previously thought to exist in nematodes.

See also [edit]

Notes [edit]

  1. ^ a b c d e f g h Roberts, Larry S., John Janovay (2005). Foundations of Parasitology (7th ed.). New York: McGraw-Hill. pp. 405–407. 
  2. ^ a b Crowley, Leonard (2009). An Introduction to Human Disease: Pathology and Pathophysiology Correlations (8th ed.). Jones and Bartlett. 
  3. ^ Combes, Claude (2005). The art of Being a Parasite (English translation ed.). The University of Chicago Press. 
  4. ^ Fong GH (2008). "Mechanism of adaptative angiogenesis to tissue hypoxia". Angiogenesis 11: 121–140. 
  5. ^ Capo VA, Despommier DD, Polvere RI (1998). "Trichinella spiralis: vascular endothelial growth factor is up-regulated within the nurse cell during the early phase of its formation". J. Parasitol. 84: 209–214. 
  6. ^ Novo E, Cannito S, Zamara E, Valfre di Bonzo L, Caligiuri A, Cravanzola C, et al. (2007). "Proangiogenic cytokines as hypoxia-dependent factors stimulating migration of human hepatic stellate cells". Am. J. Pathol. 170: 1942–1953. 
  7. ^ a b c "Trichinella". WikiVet. Retrieved 12 October 2011. 
  8. ^ a b c Roy, Sharon L., Adriana S. Lopez, and Peter M. Schantz. "Trichinellosis Surveillance --- United States, 1997--2001." Center for Disease Control
  9. ^ National Pork Board. Trichinae Herd Certification. Des Moines, Iowa: National Pork Producers Council, 2000. Available at http://www.aphis.usda.gov/vs/trichinella/.
  10. ^ "Trichinella spiralis". Genome. NCBI. Retrieved 2012-04-19. 
  11. ^ Mitreva M, Jasmer DP, Zarlenga DS, Wang Z, Abubucker S, Martin J, Taylor CM, Yin Y, Fulton L, Minx P, Yang SP, Warren WC, Fulton RS, Bhonagiri V, Zhang X, Hallsworth-Pepin K, Clifton SW, McCarter JP, Appleton J, Mardis ER, Wilson RK (March 2011). "The draft genome of the parasitic nematode Trichinella spiralis". Nat. Genet. 43 (3): 228–235. doi:10.1038/ng.769. PMC 3057868. PMID 21336279. 
  12. ^ Gao F, Liu X, Wu XP, Wang XL, Gong D, Lu H, Xia Y, Song Y, Wang J, Du J, Liu S, Han X, Tang Y, Yang H, Jin Q, Zhang X, Liu M (October 2012). "Differential DNA methylation in discrete developmental stages of the parasitic nematode Trichinella spiralis". Genome Biol. 13 (10): R100. doi:10.1186/gb-2012-13-10-r100. PMID 23075480. 

References [edit]

  • Despommier DD, Gwadz RG, Hotez P, Knirsch C (2002). Parasitic Diseases (5th ed.). New York: Apple Trees Pub. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!