Overview

Brief Summary

Although infection by the Pork Tapeworm (Taenia solium) is the primary cause of human cysticercosis, the larval stage of other Taenia species (including T. taeniaeformis) can infect humans in various sites of localization, including the brain, subcutaneous tissue, eye, or liver. (Centers for Disease Control Parasites and Health website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Taenia taeniaeformis is found worldwide where suitable hosts are present. It is not specific to any particular region.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical ; australian

Other Geographic Terms: cosmopolitan

  • Andreevich, A. 1963. Anoplocephalate Tapeworms of Domestic and Wild Animals. Moscow: The Academy of Sciences of the USSR.
  • Barnes, R. 1963. Invertebrate Zoology. Philadelphia: Saunders.
  • Meglitsch, P. 1967. Invertebrate Zoology. New York: Oxford University Press.
  • Smyth, J. 1969. The Phisiology [PHYSIOLOGY] of Cestodes. San Francisco: W.H. Freeman.
  • Yamaguti, S. 1953. Systema Helminthum. Tokyo: The Author.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The adult Taenia taeniaeformis can be subdivided into three body sections. The anterior region in called the scolex, which is used to adhere to the intestine of the host species. In T. taeniaeformis, the scolex is made up of four large suckers arranged around the sides. Behind the scolex is the neck region, and finally the third region is the strobilus. The strobilus is made of many linearly arranged sections which make up the greater part of the worm. Each section contains a proglottid (the reproductive area of the worm). The neck region is fairly small, almost nonexistent, and it produces the proglottids by way of transverse constrictions. The youngest proglottids are therefore at the anterior region and they increase by size and maturity as they reach the posterior of the strobila. The tapeworms' nervous system and protonephridial system run through the segments. A large anterior nerve mass is located in the scolex and two lateral longitudinal cords extend through to the strobilus.

The tapeworm cuticle plays a very vital role in this species. It is important in the absorption of food since the worm lacks its own digestive system. It can reach anywhere from 15 cm to 60 cm and has one proglottid per segment with both males and female reproductive systems opening laterally.

Range length: 15 to 60 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Taenia taeniaeformis infects mainly rodents and cats so it is mainly a terrestrial organism. In unusual circumstances, it has been found in humans, but that instance is extremely rare. It infects cats mainly by way of mice. The mouse will be infected (secondary intermediate host) and when it is eaten by the cat, the worm will develop to its adult stage in the intestine of the feline.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Taenia taeniaeformis are internal parasites that absorb food through their body surface because they lack a digestive system of their own. Since they are located in the intestines of their host, they take advantage of the already digested food and directly absorb the nutrients. Although not often, the scolex (which bears the suckers) is sometimes able to absorb materials not available to the other body segments, but absorption mainly occurs throughout the segments.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Taenia taeniaeformis infects mainly rodents and cats. In unusual circumstances, it has been found in humans, but that instance is extremely rare.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These animals are probably not preyed on directly but are ingested. Egg and larval mortality are high since the parasite often do not reach appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / parasite / endoparasite
Cystocercus larva of Taenia taeniaeformis endoparasitises body cavity of Rattus

Animal / parasite / endoparasite
Cystocercus larva of Taenia taeniaeformis endoparasitises body cavity of Mice

Animal / parasite / endoparasite
usually solitary tapeworm of Taenia taeniaeformis endoparasitises small intestine of Felis domesticus
Other: major host/prey

Animal / parasite / endoparasite
usually solitary tapeworm of Taenia taeniaeformis endoparasitises small intestine of Canis familiaris
Other: unusual host/prey

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Cystocercus larva of Taenia taeniaeformis endoparasitises liver of Clethrionomys glareolus

Animal / parasite / endoparasite
usually solitary tapeworm of Taenia taeniaeformis endoparasitises small intestine of Vulpes vulpes

Animal / parasite / endoparasite
usually solitary tapeworm of Taenia taeniaeformis endoparasitises small intestine of Strigiformes

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Cestodes in general have sensory organs in the scolex, which are attached to longitudinal nerves extending down the body. The nerves are attached to organs and the cestodes can detect tactile stimulation.

Communication Channels: tactile

Perception Channels: tactile

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Taenia taeniaeformis infects intermediate hosts, including arthropods and vertebrates. The oncosphere, which hatches from an egg, makes up the basic larval stages. First, a rodent, most likely a rat, ingests the egg. The embryo emerges with hooks and uses the hooks to dig into the rat's tissues. They enter the gut and arrive in the liver via the blood. They do not migrate in the liver, but immediately begin developing into strobilocerci, which are housed in cyst-like tissue. From this, the strobilus and bladder are digested, and the scolex attaches to the small intestinal mucosa and matures in the host to become the adult tapeworm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Each proglottid goes through a complete reproductive process and the reproductive system within each section takes up a majority of the space. The tapeworm is hermaphroditic, with each proglottid containing both a male and female systems. Sometimes fertilization between proglottids or even in the same proglottid occurs, but it is very rare. Usually reproduction involves two worms.

The male system consists of numerous testes sporadically placed throughout or lying in lateral fields. Sperm ductules all unite within the proglottid to form the sperm duct, which coils and enters the copulatory complex. The male system ends in an intromittent organ, the cirrus contained in a cirrus sac. To form a propulsion vesicle, the muscles of the sperm duct or the ejaculatory duct dilate.

In the female system, a single, dorsoventrally positioned ovary lies in each proglottid. Yolk glands form a compact organ inside Taenia taeniaeformis as well. A yolk-duct system turns into a single duct, and eventually connects with the oviduct after it emerges from the ovary. With strong peristaltic contractions, an ovicapt pulls ova into the oviduct. Branching off from the oviduct, near the ovicapt, a vagina branches off and runs to the genital atrium, which contains a dilated seminal receptacle (where sperm are stored during mating). Further than the vagina, the duct continues to form a uterus, which is small at immaturity, but eventually grows to coil and branch, filled with ova. The ova leave either when the proglottid is shed, or though a small uterine pore.

During copulation, the cirrus of the male proglottid is inserted into a vaginal opening of a nearby worm. The sperm are first stored in the seminal receptacle and then released for fertilization. Eventually, terminal proglottids break away from the strobilus. The eggs are then freed when the proglottid ruptures as it is released, either in the host's intestine, or in the feces of the host.

Key Reproductive Features: simultaneous hermaphrodite; sexual ; fertilization (Internal )

Parental Investment: no parental involvement

  • Andreevich, A. 1963. Anoplocephalate Tapeworms of Domestic and Wild Animals. Moscow: The Academy of Sciences of the USSR.
  • Barnes, R. 1963. Invertebrate Zoology. Philadelphia: Saunders.
  • Meglitsch, P. 1967. Invertebrate Zoology. New York: Oxford University Press.
  • Smyth, J. 1969. The Phisiology [PHYSIOLOGY] of Cestodes. San Francisco: W.H. Freeman.
  • Yamaguti, S. 1953. Systema Helminthum. Tokyo: The Author.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Taenia taeniaeformis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGATAAGTTTAAACTGACTATTAAGTTGAATATTTACGTTGGATCATAAGCGTGTTGGTATTATTTATACTTTGTTAGGATTGTGATCTGGTTTTGTAGGTTTAAGGTTTAGTTTATTAATTCGGGTAAAATTTTTAGAACCTTATTATAAAGTTATACCATTAGATTGTTATAATTTTTTGGTTACTAATCATGGTATAATTATGATTTTTTTCTTTTTGATGCCAATTCTAATTGGAGGATTTGGTAATTATTTATTGCCATTATTAGGAGGGTTAGCAGATTTAAATTTACCTCGATTAAATGCATTAAGTGCTTGATTATTGGTTCCTTCATTAGCTTTTTTAGTAGTTAGTATGTATTTAGGAGCGGGTATTGGGTGAACATTTTATCCTCCTTTATCATCATCTTTATTTTCAGAGGGTGTTGGTGTAGATTTTTTAATGTTTTCGTTACATTTGGCTGGTGCTTCTAGCCTATTTGGTTCTATAAAATTTATTTGTACTTTGTATAGAATTTTTATGACTAATATTTTTTCTCGTACATCTATTGTACTTTGATCTTATTTGTTTACTTCTATTTTACTATTGGTAACTTTACCAGTTTTAGCAGCTGCTATTACTATGTTGCTATTTGATCGTAAATTTAGTTCTGCTTTTTTTGATCCTTTAGGTGGTGGTGATCCAGTTTTATTTCAGCATATGTTTTGATTTTTTGGTCATCCTGAGGTGTATGTATTAATTCTTCCTGGATTTGGTATTATTAGACATATATGCTTAAGAATTAGTATGTCTTCGGATGTGTTTGGTTTTTATGGTTTATTGTTTGCTATGTTTTCTATAGTTTGTTTAGGAAGAAGGGTGTGAGGTCATCATATGTTTACTGTTGGGTTAGATGTAAAGACGGCTGTGTTTTTTAGCTCTATAACTATGATTATTGGAGTACCTACAGGTATAAAGGTTTTTACATGATTGTATATGTTGTTGAATGCTCGAGTCAAAAAGAGTGATCCTGTTTTATGATGAATTGTTTCTTTTATTATTCTGTTTACGTTTGGTGGGGTTACTGGTATAGTATTATCGGCTTGTGTTTTAGATAAAGTGTTACATGATACTTGATTTGTAGTAGCTCATTTTCATTATGTTATGTCGCTTGGCTCTTATATAAGAATAATAATAATGTTTATTTGATGATGACCATTAATAACTGGTTTAAGGTTGAATAAGTGTTTATTGCAGTGTCAGTGTATAGTTTCTCAAATTGGGTTTAATTTGTGTTTTTTTCCTATGCATTATTTTGGATTATGTGGGTTACCACGTCGTGTTTGTATTTATGAATGTGCTTATAATTGAATAAATATAGTATGTACTGTTGGATCTTTTATATCGGCTTTTAGAGGGTGTTTTTTTGTATTTATTTTATGGGAATCAATAGTGAGTTCTAATTATGTTTTAGGTTCATATGGTATTTCTGGGTGTATGGCTGATTTTTTTGTGAGACCAATGGCTTGTCATAAAGATTATTATTGTTATCCTTATAGAGTTGATTACACATATGGTGTTTATTATATGCGTTGAATTGATGATTGTACATATGTTTTTGCTCGTGGGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Taenia taeniaeformis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

This tapeworm infests rats and cats, it has no direct importance toward human welfare. If humans are in direct contact with pet/domestic cats, they can possibly become a host for this tapeworm, although this is rare.

Negative Impacts: injures humans (causes disease in humans ); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Taenia taeniaeformis


A pair of Taenia oncospheres, resembling sesame seeds and each containing a single bladderworm.

Taenia taeniaeformis is a parasitic tapeworm, with cats as definitive hosts. Two drugs known to be 100% effective in removing this infection are praziquantel and epsiprantel (Cestex, Banminth) which are often combined with pyrantel. The intermediate hosts of this tapeworm are rodents and lagomorphs (rabbits) which the cat must kill and eat in order to acquire the tapeworm infection.[1] This species of tape worm is much less frequently encountered than Dipylidium caninum, which has fleas as its intermediate host rather than rodents but exhibits most of the same physical characteristics and is treated with the same medications (i.e., antihelminthics).

Infection in the cat will develop and become obvious between 30 and 80 days after the cat has ingested the infected liver of a prey animal. Once the infection is established, it can last for between seven months and three years. A cat will produce between three and four motile segments per day either excreted in the feces or through direct migration, each containing between 500 and 12,000 eggs. Spontaneous worm destrobilization (the shedding of the entire portion of the body located behind the scolex and containing all of the strobila) may occur without any change in actual infection. Once shed, the proglotids are often very active and are capable of crawling considerable distances as they shed their eggs. Actual eggs are spheroid and are between 31 and 36 micrometers in diameter.[2]

Superinfection in cats is possible if they are fed young tapeworms in the presence of established mature ones.[2]

References[edit]

  1. ^ Little, S. (2011). The Cat: Clinical Medicine and Management. Elsevier Health Sciences. ISBN 9781437706611. 
  2. ^ a b Bowman, D. D.; Hendrix, C. M.; Lindsay, D. S.; Barr S. C. (2008). Feline Clinical Parasitology. John Wiley & Sons. p. 223. ISBN 9780470376591. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!