Overview

Brief Summary

Biology

Due to the saola's relatively recent discovery and the remoteness of its range, little information on this elusive species' behaviour has been gathered. Locals have said that the species is generally solitary, although there have been a few reports that the saola sometimes travels in small groups (8). Most of the data on reproduction comes from a single pregnant female from northern Lao. Calculations made from the size of this female's foetus, together with all other data to date, suggest that the saola is a seasonal breeder, mating between late August and mid-November. If this is the case, births would be timed to coincide with the onset of the monsoon, somewhere around April, May and June in northern Lao (2) (8). A single captive individual has provided the source of most behavioural information on this species. The individual was primarily diurnal or crepuscular, with activity often concentrated early in the morning and late in the afternoon (2). The saola browses on the fleshy herb layer of riverside vegetation (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The astonishing discovery of this unusual, long-horned bovid in 1992 is generally considered to be the greatest animal find of recent times (3) (5). Not only is it the first large mammal to be discovered since the Kouprey (Bos sauveli) in 1936, but it is also so different from any previously known species that a separate genus was constructed for it (2) (6). Both males and females have long, slender horns that are up to 52 centimetres in length, almost straight but with a slight curve backwards, and which are thought to be used for protection against predators and possibly in intraspecific conflict (2) (3). The short glossy coat ranges from a rich chestnut brown to almost black, generally being paler on the belly than the back, with a thin black line extending down the spine and white patches on the side of the neck of some individuals (2) (3). The tail is split into three bands of colour - brown at the top, cream in the middle, and black towards the end, tipped in a fluffy tassel (2). A cream-coloured band marks the rump, and white bands encircle the lower legs, just above the hooves (3). The brown face has a somewhat variable pattern of white spots and slashes, the most noticeable of which are the long, thin stripes above each eye, giving the appearance of eyebrows (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs only in the Annamite Mountains of Viet Nam and the Lao Peoples' Democratic Republic (Lao PDR) (Grubb 2005). Most records are from south of the Song Ca River in Viet Nam, although a population to the north has also been found (Dung et al. 1994, Kemp et al. 1997).

In Lao PDR, records come from as far west as central Bolikhamxay Province. Suitable habitat is, or was, probably more abundant in Viet Nam than in Lao PDR, but Viet Nam's much higher human population density has severely reduced both habitat and Saola numbers in the habitat that remains. In Lao PDR there is evidence of occurrence in Bolikhamxay, Khammouan, Savannakhet and Xekong Provinces; it probably also occurs in southern Xieng Khouang Province. In Viet Nam there is evidence of occurrence in Nghe An, Ha Tinh, Quang Binh, Quang Tri, Thua-Thien Hue and Quang Nam Provinces. It is suspected to occur in less than 15 forest blocks in the two countries.

The species' altitudinal range is 200 to 1,200 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Pseudoryx nghetinhensis is found in few mountainous areas of Vietnam and Laos PDR (People's Democratic Republic), near the Lao PDR and Vietnam border. Saola have one of the smallest ranges of mammals in the world, and are found in only 6 provinces in Vietnam and 3 provinces in Laos PDR.

Biogeographic Regions: oriental (Native )

  • Dung, V., P. Giao, N. Chinh, D. Tuoc, P. Arctander. 1993. A new species of living bovid from Vietnam. Nature, 363: 443-445.
  • Duckworth, J., R. Salter, K. Khounboline. 1999. Wildlife in Lao PDR: 1999 Status Report. Vientiane: IUCN- The World Conservation Union/ Wildlife Conservation Society/Centre for Protected Areas and Watershed Management: 1-275. Accessed November 16, 2004 at http://wcs.org/sw-around_the_globe/Asia/laos/wildlifeinlaopdr.
  • Robichaud, W. 1998. Physical and behavioral description of a captive saola, Pseudoryx nghetinhensis . Journal of Mammalogy, 79/2: 394-405.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The entire range of the saola lies within a narrow area of forests along the northern and central Annamite mountain range, on the border between Vietnam and the Lao People's Democratic Republic (2) (6). While most records come from south of the Song Ca River in Vietnam, populations to the north have also been found (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Saloa are large animals, measuring around 150 cm and weighing in between 80 and 100 kg. Although not reported for soala, sexual dimorphism is common in bovids, and may occur in this species.

Both males and female saola have horns that are probably used for protection against predators. The common name, saola, means "spinning wheel posts" in the local language. This name was probably given to the species because of the way the horns resemble tapered posts of a spinning wheel.

These animals have brown noses. The pelage consists of different shades of brown. Some have white patches on the side of neck. A black stripe extends from the shoulders to the lower back. The underside of is a lighter shade of brown than the upper body. The tail is striped, with brown, black, and cream colors. The rump is marked by a cream colored band which extends horizontally from the top of one hind leg to the other. White bands encircle the lower leg, just above the hooves. The face has white patches that conceal small dermal nodules that may be scent glands. Saola have possibly the largest maxillary glands of any living mammal.

Range mass: 80 to 100 kg.

Average length: 150 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species occurs in the northern and central Ammanites, in climatically wet evergreen forest (Duckworth et al. 1999, Lunde et al. 2004), and is present only in forest blocks over approximately 25 square kilometers (R. Timmins pers. comm.2006). The habitat preference appears to be highly specific, namely evergreen forests with little or no dry season. Saola have been found in high quality, dense forest. Whether or not it can inhabit other types of wet forest is not known. It may associate with areas close to forested streams (Dung et al. 1993). Thus, many areas within the presumed range in both Lao PDR and Viet Nam are not suitable due to the predominance of forests with pronounced dry seasons, limestone forests, etc.

The altitude range of the Saola is uncertain. While it seems to be a mid-low elevation species, most of the forest below 400 m within its presumed range has been lost and a high proportion of the remaining forest is over 1,000 m. There is no indication that the species occurs above 1,200 m.

Information from villagers in its range indicates that Saola are mainly solitary, although there are some reports of groups of two or three animals, and rarely groups as large as six or seven (Dung et al. 1994). The species is possibly territorial, and might mark territory with scent from its large maxillary gland.

Single foetus pregnancy has been documented. Information from local villagers suggests this to be the norm (Robichaud 1998). Saola may have a fixed breeding season with births occurring in the summer.

Captive Saola exhibited primarily diurnal, or diurnal and crepuscular, activity; however, it is not known if this is typical under natural conditions (Robichaud 1998). Local reports suggest Saola is a browser, feeding mostly on leaves (Dung et al. 1994).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Saola prefer broadleaf evergreen forests that are in the wet lowland Annamite Mountains of Laos PDR and Vietnam, including marshes and swamps. They are found at elevations between 400 and 750 m. The habitat has long rainy seasons with high average annual rainfall

Range elevation: 400 to 750 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Wetlands: marsh ; swamp

  • Hardcastle, J., S. Cox, N. Thi Dao, A. Johns. 2004. Rediscovering the Saola. Proceedings of the "Rediscovering the saola- a status review and conservation planning workshop": 1-115. Accessed November 14, 2004 at http://www.panda.org/downloads/ecoregions/saolaproceedingenglish.pdf.
  • Kemp, N., M. Dilger, N. Burgess, C. Dung. 1997. The saola Pseudoryx nghetinhensis in Vietnam- new information on distribution and habitat preferences, and conservation needs. Oryx, 31/1: 37-44.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The saola typically inhabits wet, evergreen, broadleaf forests, usually between 400 to 1,000 metres, along steep river valleys (7). Areas of low human disturbance are preferred but swidden fields are often entered (8). The species appears to occupy higher elevations during the wet season when upper streams have plenty of water, and lowlands during the dry season when the mountain streams have dried up (2) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Saola are herbivores, primarily eating ferns and flowering plants (angiosperms).

Plant Foods: leaves; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Not much is known about the role saola play in the ecosystem. Since there are few saola, they probably do not greatly impact the surrounding vegetation. Although they provide potential prey to carnivorous mammals, because they are so rare it is unlikely that saola are important in local food webs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Natural predators of saola are tigers, leopards, and dholes although humans are the major predator of saola and threaten their existence. When threatened, saola use their sharp-tipped horns for protection from predators by lowering their heads to strike the predator. Although they don't appear to be frightened by humans, saola are terrified of dogs. While running from predators, their glands swell and they snort.

Known Predators:

  • tigers
  • leopards
  • dholes
  • humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Saola in captivity have been observed bleating for unknown reasons. Some researchers suggest that twig breaking with horns may be a form of social and/or sexual communication. They also possess scent glands under the white markings on their faces, indicating the importance of chemical communication in this species. Although not specifically reported, we can infer that tactile communication is important during mating and rearing of young. Because these animals might have some activity during daylight hours, there may also be visual communication between individuals based on body postures and other visual signals.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Little is known about the development of saola

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the life span in the wild, but in captivity, saola generally do not survive greater than 5 months. This is probably due to stress and lack of proper nutrition. Other members of the subfamiliy Bovinae can live 15 to20 years in the wild, and it is likely that this species is similar.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating takes place between August and November. It is unknown if saola exhibit any mating rituals.

There is little information available on the mating systems of saola, but estimations were made from examining a dead pregnant female. Saola give birth between April and June. It is not known whether saola use their horns as display for mating purposes. They are similar to other Bovinae, like four-horned antelope, in that gestation lasts 8 months. Saola only have one offspring per litter.

Other information on reproduction in this species is not available. These animals were only recently recognized as a species, and are quite rare.

Breeding interval: Saloa appear to breed once per year.

Breeding season: Breeding apparently takes place between August and November.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Average gestation period: 8 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

There is little information available on parental investment of saola, although Artiodactyl young are generally precocious. Like other members of the family, it is likely that most parental care is provided by the mother. Young receive nourishment from mother's milk, protection from mother, and probably some form of grooming. It has not been reported how long young are dependent upon the mother, although if soloa are like other members of the family, it is likely to be around one year.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Hardcastle, J., S. Cox, N. Thi Dao, A. Johns. 2004. Rediscovering the Saola. Proceedings of the "Rediscovering the saola- a status review and conservation planning workshop": 1-115. Accessed November 14, 2004 at http://www.panda.org/downloads/ecoregions/saolaproceedingenglish.pdf.
  • Robichaud, W. 1998. Physical and behavioral description of a captive saola, Pseudoryx nghetinhensis . Journal of Mammalogy, 79/2: 394-405.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudoryx nghetinhensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGACTATTCTCAACTAACCATAAAGACATTGGTACCCTATACCTACTATTCGGTGCCTGAGCTGGCATGGTAGGAACCGCCCTAAGCCTGCTAATTCGCGCTGAACTAGGTCAACCCGGCACTCTGCTCGGAGATGACCAAATCTATAATGTAATTGTAACCGCACACGCATTTGTAATGATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTCGGTAACTGACTCGTTCCTTTAATAATTGGTGCTCCTGATATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTGCTACTCCTAGCATCATCTATAGTTGAAGCTGGAGCAGGGACAGGCTGAACTGTATATCCCCCTCTAGCAGGCAACCTAGCCCACGCAGGAGCTTCAGTTGACCTAACTATTTTCTCCTTACATTTAGCGGGTATCTCTTCTATCCTAGGAGCCATTAACTTTATTACAACAATTATTAACATAAAGCCTCCTGCAATATCACAATACCAAACTCCCCTTTTCGTATGATCCGTGATAATTACTGCCGTATTATTACTCCTCTCACTTCCCGTACTAGCAGCTGGTATTACAATATTATTAACAGACCGAAATCTAAACACAACTTTCTTCGACCCAGCAGGAGGAGGGGACCCTATCCTATATCAACATTTATTTTGATTTTTTGGACACCCTGAAGTTTATATTCTTATTTTACCTGGATTTGGAATAATCTCTCATATTGTAACTTACTACTCAGGCAAAAAAGAACCATTCGGGTATATAGGAATAGTCTGAGCCATAATATCAATCGGATTTTTAGGTTTTATTGTATGAGCCCATCATATATTCACAGTCGGAATAGATGTTGACACACGAGCCTACTTCACATCAGCTACTATAATTATTGCTATCCCAACCGGAGTGAAAGTCTTTAGCTGACTAGCAACACTCCACGGAGGTAATATCAAGTGATCTCCCGCTATAATATGAGCCCTGGGATTTATCTTTCTTTTCACAGTGGGAGGCTTAACCGGGATCGTCCTAGCCAACTCCTCCCTCGATATTGTTCTCCACGATACATATTATGTTGTTGCACACTTCCACTACGTTTTATCAATAGGAGCTGTATTTGCTATTATAGGAGGCTTTGTACATTGATTCCCACTATTCTCAGGATATACTCTCAATGACACGTGAGCCAAAATTCACTTCGCAATTATATTTGTAGGCGTTAACATGACCTTTTTCCCACAGCACTTTTTAGGATTATCTGGCATACCACGACGATACTCCGATTATCCAGACGCATATACAATATGAAATACTATCTCCTCAATAGGCTCATTTATTTCTCTAACAGCGGTTATACTAATAGTCTTCATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTCCTAACTGTAGATATAACCACAACAAATCTAGAATGATTAAACGGGTGCCCTCCACCGTATCACACATTTGAAGAGCCCACATATGTCAGCCTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudoryx nghetinhensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd+3cd+4cd; C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Timmins, R.J., Robichaud, W.G., Long, B., Hedges, S., Steinmetz, R., Abramov, A., Do Tuoc & Mallon, D.P.

Reviewer/s
Hedges, S., Timmins, R.J., Robichaud, W.G. & Long, B. (Asian Wild Cattle Red List Authority)

Contributor/s

Justification
The species is listed as Critically Endangered. All available information indicates that the species is in a clear and protracted decline throughout its small range due to intense hunting pressure, accelerated by continued fragmentation of its habitat to increased human access (mainly through road construction). No part of the species' extent of occurrence is effectively protected from hunting. Local hunters in the species' range commonly go years without seeing an animal, indicating very low and suppressed population density. Threats from hunting are exacerbated by other factors including loss of habitat. The new Ho Chi Minh Road through the Annamite Mountains in Viet Nam, (with additional roads branching to Lao PDR) is a major and probably unmitigatable threat. Rates of decline are likely to increase rather than decrease, and a population reduction of 80% over three generations is estimated for the past, present and future (=A2cd+3cd+4cd). The remaining population is estimated at Pseudoryx conference convened in Viet Nam in 2004 (Hardcastle et al. 2004).

History
  • 2007
    Critically Endangered
  • 2006
    Critically Endangered
  • 2006
    Critically Endangered
    (IUCN 2006)
  • 2003
    Endangered
    (IUCN 2003)
  • 2003
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Creative Commons Attribution 3.0 (CC BY 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Saola are listed as endangered. The primary threat to these animals is hunting and loss of their forest habitat due to agriculture and logging. Locals place a high value on saola because of their scarcity. Many hunters also try to capture live saola because of their importance to the scientific community. Saola don't do well in captivity, and die soon after capture. Intense conservation efforts were started in 1997 to ensure the survival of these creatures.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The area of forest remaining in the known historical range of the Saola is 5,000 to 15,000 sq. km, but much of this range is probably no longer inhabited by the species. The number of Saola subpopulations - defined as those in non-contiguous blocks of habitat - is probably in the order of 6 to 15, and none likely number more than 50 animals. Consequently, total Saola population is undoubtedly less than 750, but is likely much less.

No formal surveys have been undertaken to estimate Saola numbers accurately (Tham Ngoc Diep et al. 2004). Accurate population estimates would be exceedingly difficult to obtain due to the secretive nature of the taxon, the difficulty in making direct observations in dense forest habitat - a difficulty compounded by the species' rarity - the rugged terrain, and the remoteness of much of its habitat. Furthermore, one of the two range governments, Lao PDR, has often withheld permission to conduct detailed studies of the species in its territory. Nonetheless, it is known that subpopulations are small, highly localised, and isolated.

To date, scientists have categorically documented Saola in the wild on only four occasions. In fact, there is not yet a reliable method for detecting the species other than direct observation or camera trapping. Incidences of either of these encounters are extremely rare. The first photograph of a Saola in the wild was taken in 1998 from a camera trap set near a mineral spring in Pu Mat National Park, Viet Nam (Whitfield 1998). A few months later the species was camera-trapped in Lao PDR, in Bolikhamxay Province (Robichaud 1999). The only other potentially reliable method of detection is through genetic analysis of feces.

The paucity of data on Saola is itself an indication of its critically small population. Though populations of other ungulates in the Saola's range are severely depressed, they are seen far more commonly by local inhabitants than is the Saola. Recorded sightings of these ungulates occur at a frequency often two orders of magnitude higher than for the Saola. Documented villager sightings of Saola in the past decade don't number in the thousands or hundreds, but in the tens. In contrast, sightings by villagers of muntjacs, pigs and even Sambar are so common that researchers generally don't quantify them.

Analysis of hunter interviews conducted in In Pu Mat National Park, Viet Nam in 1998 and 1999 estimated that about 18 Saola survived in the Khe Bong area in the southeast of the reserve and about eight in the Khe Chat and Khe Choang areas in the center. In 2003, research suggested that these numbers had been reduced by about 50% over the intervening five years, despite the best efforts of the forest authorities and other responsible agencies (Weir and Dinh Van Cuong 2004).

Speculative population estimates of 70 to 700 in Lao PDR and several hundred in Viet Nam were provided in the IUCN Antelope Action Plan (Mallon and Eames 2001, Timmins 2001). Subsequent surveys in Lao PDR indicated that the current population there is likely near the country's low estimate, i.e., fewer than 100 remaining (Robichaud and Timmins, 2004). It is unlikely that Saola's total global population is greater than the low hundreds at most (i.e., fewer than 250 mature individuals). Such a total estimate was made in the 1990s, based on the known range and reports from hunters (Dung et al. 1993, Schaller and Rabinowitz 1995). The situation has deteriorated considerably since then. The surviving population is highly dispersed and its fragmentation is worsening. Saola numbers may be so low that no viable populations remain.

There are no Saola known in captivity.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
While tropical forests have inherently low ungulate biomass, natural Saola densities are probably even lower than other sympatric ungulates such as wild pigs, Sambar, and muntjacs. This is due in part to the presumed lower reproductive output, solitary nature, and likely larger territory and/or home range of the Saola as compared to some of these other ungulates. It is clear that Saola populations must also be unnaturally depressed, as populations of all wild animals larger than 20 kg in its range have been significantly reduced by human exploitation. Field survey encounter rates with muntjacs and pigs in the Saola's range are remarkably low compared to other areas in Asia, and wild cattle, elephants, and tigers are all nearing extinction in its range (e.g., Duckworth and Hedges 1998). Even typically resilient species such as Sambar are scarce. The declines are corroborated by local villagers across the area, who consistently report major reductions from former abundances.

The greatest threat to Saola is hunting. While wildlife in the Saola's range are most threatened by the traditional medicine trade, specific demand for Saola is almost non-existent as the species is unknown in the traditional Chinese pharmacopoeia. Instead, the animal is snared incidentally in the intense, general pursuit of other species for the medicine and bushmeat trade.

Local subsistence hunting also takes a toll. Saola may be particularly susceptible to being hunted with dogs (Robichaud 1998). The intensity of hunting in the Saola's range is hard to adequately describe, but some figures hint at the enormity of the problem. The human population of Viet Nam is more than 70 million, that of China more than a billion. Together, they comprise an enormous market for wildlife products. For example, tens of millions of wild turtles are imported, legally and illegally, into China annually (van Dijk et al. 2000 and papers therein).

The bushmeat trade is more localized, but it is estimated that eight million Viet Namese, i.e., eight million people with the propensity to eat wildlife, live within 100 km of forest inhabited by Saola. It is unlikely that any Saola occur more than 35 km from a village. The pressure from proximal human settlements is so intense that there are no longer core areas in the Saola's range not regularly reached by hunters. Every square kilometre of Viet Namese and Lao forest within Saola range probably has snares capable of capturing Saola set in it every year. Intensity in some areas probably reaches many thousands of snare-nights per square kilometre per year.

Habitat destruction is also a threat to the Saola, forests in their range being cleared for small-scale agricultural use, timber extractions, roads, and hydropower development. However, there continues to be more Saola habitat than there are Saola.

Presumably, the generation time of Saola is greater than three years, and reproductive output is lower than that of muntjacs, Southern Serow or Sambar, putting Saola at a conservation disadvantage. Additionally, pigs, Southern Serow, muntjacs and Sambar retain significant population reservoirs in areas of lower hunting pressure, such as difficult to reach areas of habitats such as dry evergreen forest that are not amenable to Saola. The absence of Saola from such habitats is either an indication of a greatly accelerated rate of decline as compared with other species or an ecological intolerance, neither of which bodes well for the species.

Finally, the bushmeat trade has little likelihood of abating as long as there are pigs, muntjacs, and civets to be hunted, but Saola will become extinct long before these more common species are hunted out. In Viet Nam, informal interviews with hunters in Pu Huong Nature Reserve revealed that 30 Saola were killed there between 1995 and 2003 (Hoang Xuan Quang and Cat Tien Trung 2004). In some local villages in Viet Nam, hunters used to kill three individuals per year 10 years ago, but now rarely catch any (Do Tuoc, Alexei Abramov pers. comm. 2006). Most hunted specimens have been killed in winter (at least in Viet Nam), when Saola are in more accessible lowland habitats (Dung et al. 1994).

Snaring is less intensive in Lao PDR, but there the majority of Saola range lies along the Viet Nam border, and is heavily poached by Viet Namese, and/or coincides with the distribution of the ethnic Hmong in Lao PDR, who avidly and effectively hunt a wide range of wildlife, including Saola. These forests are as nearly devoid of large mammals as forests in Viet Nam.

Economic development and expanding wealth in the region are likely increasing rather than decreasing the demand for wildlife medicines and bushmeat. Development projects in the region commonly cite poverty as a principal cause of biodiversity loss, but the main threat in the Saola's range, at least for the mid-term, is increasing wealth in its range countries and in China. Wealth, not poverty, is the principal driver of the wildlife trade.

The recent construction through the Annamite Mountains in Viet Nam of the Ho Chi Minh Road, parallel to and with branches to the Lao border, is a severe and probably unmitigatable new threat. It directly affects Saola subpopulations by forest fragmentation and increased human access for hunting and forest clearance in several critical areas.

Saola have proved difficult (thus far impossible) to maintain in captivity (Robichaud 1998). Approximately 20 Saola, at least, have been captured in Viet Nam and Lao PDR, and all died shortly afterwards, with exception of two released back into the wild (Stone 2006).

Protected area management has been largely ineffective in the Saola's range and existing and new protected areas offer little hope for conservation of the species. Protected areas have proved particularly impotent in the control of poaching or as a mechanism to safeguard areas from economic development. Protected areas in the region are commonly the site of hydropower projects, road construction, and mining. As yet there has been no demonstration of effective anti-hunting measures in any area in the range of Saola, nor are any likely to become effective within the next five years, at best.

Although specific trade demand for Saola has been low, it could be increasing as the species grows rarer. In 2000, horns marketed as belonging to the rare Saola were offered for sale in Hanoi, Viet Nam for US$600 (Alexei Abramov pers. comm. 2006).

Human population growth in the Saola's range is high, both from births and in-migration, which will intensify the threats to the species.

Efforts to initiate Saola conservation activities in Lao PDR have received little government support, and in some cases have been actively blocked. The reasons for this are not clear, but may be due to fear of slowing logging and hydropower development.

In summary, intense hunting and a multitude of exacerbating pressures on Saola are increasing and evidence indicates that the species, which is naturally uncommon and localized, is in a major decline. The trend is likely to result in the extinction of Saola in the foreseeable future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

After having only relatively recently been discovered, the saola is now the focus of scientific attention for another reason, for being in grave danger of extinction. The species only has a small range where it is increasingly threatened by hunting and habitat loss (1). Snare-traps and hunting dogs are used to capture the saola, whose meat is sold in affluent urban centres. In the past, hunters have also tried to capture live saola because of intense interest from the world's scientific community (3). Sadly, all of the 13 known saola captured and held in captivity to date were badly kept and with the exception of two, which were released back into the wild, died within five months (2) (7). Habitat destruction poses another threat, with forests being fragmented by infrastructure development and shifting cultivation (2) (7). In Lao, the threat of hunting is exacerbated by the creation of logging roads, which fragment the remaining forest patches and make these animals more accessible to hunters (1) (2). In particular, the new Ho Chi Minh Road is a cause for considerable concern, since it slices through the length of the species' range in Vietnam and has feeder roads branching into Lao People's Democratic Republic (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I and both of its range countries are CITES signatories. It is protected by national law in Viet Nam (Decree 48; IB) and in Lao PDR (Ministry of Agriculture and Forestry Regulation 360).

In Lao PDR Saola are probably still found in Nakai-Nam Theun and Xe Xap National Protected Areas, and in Nam Chat-Nam Pan Provincial Protected Area. However, only Nakai-Nam Theun has active, well-funded management. Saola occur in several forest blocks outside protected areas - in fact, its range in Lao PDR outside protected areas may be nearly as large as its range within, and perhaps larger. In Viet Nam it is probably found in Vu Quang and Pu Mat National Parks; Pu Huong, Phong Dien and Dak Rong Nature Reserves and the proposed Bac Huong Hoa Nature Reserve. A new protected area for the species has been proposed in Thua-Thien Hue and Quang Nam Provinces.

The highest priority areas for conservation are: 1). Southern Thua -Thien Hue-northern Quang Nam Provinces, Viet Nam (and adjacent areas of Lao PDR). 2). Eastern Bolikhamxay Province (e.g., Nam Chat-Nam Pan Provincial Protected Area), Lao PDR. 3). Transborder area of Khammouan and Savanakhet Provinces, Lao PDR and Quang Binh and Quang Tri Provinces, Viet Nam.4). Nakai-Nam Theun National Protected Area, Lao PDR and adjacent forests in Viet Nam.

Two editions of a conservation action plan for the species in Lao PDR have been written (Robichaud 1997, 1999), but permission for implementation has not been granted by the Lao government. Recommendations from a 2004 Saola workshop held in Viet Nam (Hardcastle et al. 2004) included updating and implementing the 1999 Lao Action Plan and preparation of a comprehensive Saola Conservation Action Plan for Viet Nam. The latter has now been drafted.

Highest, immediate priorities for both countries are increased patrolling against snaring and other types of hunting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The saola is found in a number of protected areas in which conservation work is underway including the Vu Quang Nature Reserve, where the Ministry of Forestry in Vietnam has now cancelled its logging operations (9) and the Pu Huong Nature Reserve, where surveys have been undertaken (7). Within the Pu Mat National Park, many surveys on the distribution and ecology of the saola were carried out between 1998 and 2003, as part of the Social Forestry and Nature Conservation (SFNC) project (7). The Ministry of Forestry in Vietnam has also issued a ban on further capture, trade, or holding of these rare animals, given their apparent inability to survive captivity (2). The WWF Greater Mekong Programme has been actively involved in the conservation of this rare species, setting up initiatives like the Vu Quang Project, which endeavoured to improve the management of the nature reserve and support the livelihoods of local people (5). WWF has also been active in establishing three new adjoining protected areas for the saola in the southern part of its range, where it is actively working with local authorities and governments to protect the species. In 2003, WWF produced a documentary showing the plight of the saola, which was shown on Vietnamese television (6), and a research programme on the saola, undertaken by WWF, is ongoing, in an effort to design a survey and monitoring protocol for the species (8). Despite concerted conservation efforts, however, the future of this unusual bovid remains uncertain, and an ongoing battle to save it now ensues. Having evaded detection for so long, it would be a great shame to science, and to nature, if such a unique species should be lost forever.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is no known adverse affects of saola on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Saola are one of the many animals that are hunted in Vietnam and Lao PDR for meat and hide.

Positive Impacts: food ; body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Saola

For typhoons named Saola, see Typhoon Saola.

The Saola, Vu Quang ox or Asian biocorn, also, infrequently, Vu Quang bovid (Pseudoryx nghetinhensis), is one of the world's rarest mammals, a forest-dwelling bovine found only in the Annamite Range of Vietnam and Laos. Cousin to cattle, goats, and antelopes,[2][3] the species was defined following a discovery of remains in 1992 in Vũ Quang Nature Reserve by a joint survey of the Ministry of Forestry and the World Wide Fund for Nature.[4] The team found three skulls with unusual, long, straight horns kept in hunters' houses. In their article, the team proposed "a three month survey to observe the living animal", but more than 20 years later, still no sighting of a saola in the wild had been reported by a scientist. However, a living saola was photographed in the wild in September 2013 by a camera trap set by the World Wide Fund for Nature and the Vietnamese government’s Forest Protection Department. Van Ngoc Thinh, the WWF's Vietnam country director, said, "This is a breathtaking discovery and renews hope for the recovery of the species."[5][6]

In late August 2010, a saola was captured by villagers in Laos, but died in captivity before government conservationists could arrange for it to be released back into the wild. The carcass is being studied with the hope that it will advance scientific understanding of the saola.[7][8] Sometimes, these animals get caught in snares that have been set to catch animals such as wild boar, sambar, and muntjac deer that come to feed on the crops the farmers have planted. This has become a problem, especially with the illegal fur trade, for medicines, restaurants, and food markets.[9] More than 26,651 snares have been removed from habitats where the saola has lived for years.[10]

Habitat and distribution[edit]

The saola inhabits the Annamite Range's moist forests and the eastern Indochina dry and monsoon forests. They have been spotted in steep river valleys at about 300 to 1800 m above sea level. These regions are distant from human settlements, and covered primarily in evergreen or mixed evergreen and deciduous woodlands. The species seems to prefer edge zones of the forests.

Saolas stay in mountain forests during the wet seasons, when water in streams and rivers is abundant, and move down to the lowlands in winter. They are shy and never enter cultivated fields or come close to villages. To date, all known captive saolas have died, leading to the belief that this species can never live in captivity.

Taxonomy[edit]

The saolas belongs to the family Bovidae-a mammal that is a member of the cattle family-, and genetic analysis places it in the tribe Bovini; its closest relatives are cattle, true buffaloes, and bison. However, its simple horns and teeth and some other morphological-branch of biology dealing with the form and structure of organisms and their specific structural features are typical of less-derived or 'primitive' bovids.[11] Saolas are antelopes, in the sense that an antelope is any bovid that is not a cow, sheep, buffalo, bison, or goat. How many individuals exist is unknown, as only 11 have been recorded alive.

Physical characteristics[edit]

An adult saola stands at about 80–90 cm at the shoulder, with its entire body length measuring around 150 cm (the tail measures additionally out to about 25 cm) and weighs 90–100 kg. Its hair is straight, short, and surprisingly soft for an animal partly adapted to a montane habitat, and is usually of a medium chocolate brown color (though some have been noted to contain variations of a reddish tone). However, this is not uniform, with both the neck and belly a slightly paler shade, as well as various white markings scattered across its body, such as white patches on the feet, vertical stripes across the cheeks, and splotches on the nose and chin. Also, a medial black dorsal strip extends from between the shoulders down and back to fade out into the top of the tail. The tail itself is tricolored and splits evenly into three horizontal bands of medium brown, cream, and black, with the cream blending into the white band that extends across its rear.[12] It bears round pupils with dark-brown irises and a cluster of white whiskers about 2 cm long that protrude from the end of the chin with a presumably tactile function. It also possesses a long tongue that can extend up to about 16 cm, with its upper surface covered in fine, rearward-pointing barbs, presumably to aid in eating.[12]

All saolas also possess a pair of slightly diverging horns that closely resemble the parallel wooden posts commonly used to support a spinning wheel (which is also the source of their namesake).[3] They are generally dark-brown or black and can measure from about 35–50 cm long; twice the length of their head.[12] The horns of the males and females bear little to no significant variations. Their skin is 1–2 mm thick over most of the body, but thickens near the nape of the neck, and at the upper shoulders, it thickens to 5 mm. This unique adaptation protects them against both predators and rivals' horns during fights.[13]

Local populations report having seen saolas traveling in groups of two or three, rarely more.

The saola possesses a pair of highly developed maxillary glands on either side of its snout, each comprising a rectangular shallow depression of about 1.5 cm deep along the upper muzzle. The depression is covered by sparse, flattened hair with rows of pores scattered throughout.[12] The entirety of each gland is covered by a muscular flap that can raise up to about 3 cm to expose scent glands used in marking territory. It then subsequently can rub the underside against objects, leaving a musky, pungent paste. The saola's colossal scent glands are thought to be the largest of any living mammal.

Behavior and reproduction[edit]

They walk with a gentle, quiet, slow nature. When they sleep, they have their fore legs tucked under their bodies, necks extended, and the chin resting on the floor. Villagers reported that saolas are active in the mornings, afternoons, and nights, but not when the sun is overhead.

They are calm in the presence of humans, letting humans pet them and eating out of their hands. However, they have an intense fear of dogs. When they feel threatened, they contract defensive positions which involve the snorting and thrusting of their heads forward, exposing their long, straight horns. Their ears are pointed up and straight back with arched backs and stiff postures. Occasionally, they secrete the paste from their maxillary glands as a defensive reaction, which is usually and most commonly observed with dogs. Saola vocalize with bleats.

To mark their territories, saolas open a fleshy flap located over their maxillary glands on either side of the snout and rub it over a rock or place of territory, leaving a strong, musky paste. To defecate and urinate, saolas drop their hind legs and lower the lower body, urinating and defecating separately, which is not new for bovid species.

Saolas spend a significant amount of time grooming themselves. They lick their faces and eyes most often and lead into their shoulders and fore legs. They frequently lick their muzzles to disperse flies, as well.

Very little information is available about their reproductive and pregnancy cycles; however, they give birth to single calves. A female saola held captive died pregnant with a male calf, which was well formed and had distinguishable features. For lack of information and proper resources, scientists estimate the gestation period as similar to those of Tragelaphus species; that is, about 234 days.

Diet[edit]

They are reported to eat small leafy plants, especially fig leaves and stems, along rivers. While little is known about the full range of their diet, saolas in captivity generally subsist on a diet of leafy plants such as a Asplenium fern species (also known as spleenwort), broad dark-green plants of the Homalomena genus, and various species of broad-leaved shrubs or trees of the Sterculiaceae family. They have shown to have a greater preference for the unidentified plant of the Sterculiaceae family/Sterculia genus.[12] Seldom have they been reported eating during periods of darkness, most likely due to their diurnal nature. The animal seems to have a browsing diet, considering its small incisors.

Names[edit]

The name saola has been translated as "spindle[-horned]" although the precise meaning is actually "spinning-wheel post horn". The name comes from a Tai language of Vietnam, but the meaning is the same in the Lao language. The specific name nghetinhensis refers to the two Vietnamese provinces of Nghệ An and Hà Tĩnh while Pseudoryx acknowledges the animal's similarities with the Arabian or African oryx. Hmong people in Laos refer to this beast as saht-supahp, a term derived from Lao meaning "the polite animal", because it moves quietly through the forest. Other names used by minority groups in the Saola's range are lagiang (Van Kieu), a ngao (Ta Oi) and xoong xor (Katu) [14] In the press,[7] saolas have been referred to as "Asian unicorns". The appellation is apparently due to the saola's rarity and apparently gentle nature and perhaps because both the saola and the oryx have been linked with the unicorn. No known link with the mythical beast is known; nor with the "Chinese unicorn", the qilin. The saola has been an easy target for hunters due to its docile nature. Additionally, it is occasionally caught by snares set by villagers for wild boar. Feral and domestic dogs present another threat, as the ecology of the area historically has included a canine predator. In several instances, the villagers hang the horns of the saola as a symbol of honor. Such trophy hunting endangers the species as a whole because they have very little defense and can be overpowered quite easily. Little money is available to fund the awareness of the endangered status of this species, let alone for its conservation, so trophy hunting continues with no regulation.

Another large threat to the saola species is habitat fragmentation. Due to their shy nature and preference for undisturbed forests, the habitable region for the saola continues to shrink. They are restricted to high mountain areas where perhaps a few dozen to a few hundred animals remain.

Evolution[edit]

In 1992, the saola was discovered within the restricted mountainous region that separates Vietnam and Laos. Only a few hundred of them are reported in the wild. The horn cores of the adult saola are exceptionally long, and the genetic name Pseudoryx refers to the superficial resemblance of the oryx (tribe Hippotragini). As compared to other bovid genera, Pseudoryx differs significantly from all described in appearance and morphology. The Bovidae are composed of two major subfamilial clades, based on molecular investigations of ribosomal mitochondrial sequences of a large taxon sample. The first clade corresponds to Bovidae and assembles members of the tribes Bovini (cattle and buffaloes), Tragelaphini (African spiral-horned bovids) and Bosalaphini. The second clusters all other bovids, which is composed of Caprini (goats and muskox), Hippotragini (horse-like antelopes), and Antilopini (gazelles). Phylogenetic information for deciphering Bovidae evolution can be found in mitochondrial and nuclear sequences.[15]

Conservation[edit]

The Saola Working Group was formed by the IUCN Species Survival Commission's Asian Wild Cattle Specialist Group, in 2006[16] to protect the saolas and their habitat. This coalition includes about 40 experts from the forestry departments of Laos and Vietnam, Vietnam's Institute of Ecology and Biological Resources, Vinh University, biologists and conservationists from Wildlife Conservation Society, and the World Wide Fund for Nature.[17]

Due to the saola being critically endangered, a group of scientists from the Vietnam Academy of Science and Technology in central Hanoi, within the Institute of Biotechnology, has looked into a last resort effort of conserving the species by cloning. This can prove to be quite difficult because cloning even the most well-known mammal can be difficult. It would be even more so with a mammal about which researchers know little to nothing, such as the saola.[3]

See also[edit]

Other rarely seen large mammals of the Indochina peninsula, also discovered in the 1990s:

References[edit]

  1. ^ Timmins, R. J.; Robichaud, W. G.; Long, B.; Hedges, S.; Steinmetz, R.; Abramov, A.; Tuoc, D.; Mallon, D. P. (2008). "Pseudoryx nghetinhensis". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 2013-11-14. 
  2. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 695. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ a b c Stone, R. (2006). "The Saola's Last Stand". Science 314 (5804): 1380–3. doi:10.1126/science.314.5804.1380. PMID 17138879. 
  4. ^ Dung, Vu Van; Giao, Pham Mong; Chinh, Nguyen Ngoc; Tuoc, Do; Arctander, Peter; MacKinnon, John (1993). "A new species of living bovid from Vietnam". Nature 363 (6428): 443. doi:10.1038/363443a0. 
  5. ^ "Saola sighting in Vietnam raises hopes for rare mammal's recovery: Long-horned ox photographed in forest in central Vietnam, 15 years after last sighting of threatened species in wild", The Guardian, (November 13 2013).
  6. ^ "Saola Rediscovered: Rare Photos of Elusive Species from Vietnam", World Wildlife Federation (February 13 2013).
  7. ^ a b "Rare antelope-like mammal caught in Asia". BBC News. 16 September 2010. Retrieved 16 September 2010. 
  8. ^ "Rare Asian 'Unicorn' Sighted, Dies in Captivity". livescience.com. Retrieved 16 September 2010. 
  9. ^ "Saola | Species | WWF." WWF - Endangered Species Conservation World Wide Fund for Nature. N.p., n.d. Web. 24 April 2013
  10. ^ " Home - Saola Working Group ." N.p., n.d. Web. 18 April 2013
  11. ^ Bibi, Faysal; Vrba, Elisabeth S (2010). "Unraveling bovin phylogeny: Accomplishments and challenges". BMC Biology 8: 50. doi:10.1186/1741-7007-8-50. PMC 2861646. PMID 20525112. 
  12. ^ a b c d e Robichaud, William G. (1998). "Physical and behavioral description of a captive saola, Pseudoryx nghetinhensis". Journal of Mammalogy 79 (2): 394–405. doi:10.2307/1382970. JSTOR 1382970. 
  13. ^ "Saola (Pseudoryx nghetinhensis) - Detailed information." www.ultimateungulate.com. N.p., n.d. Web. 18 April 2013
  14. ^ Tham Ngoc Diep, Dang Thang Long and Do Tuoc, Report on Survey of Saola Pseudoryx nghetinhensis Appendix 3 in Rediscovering the Saola Workshop proceedings, Hanoi 2004
  15. ^ Hassanin, A.; Douzery, E. J. P. (1999). "Evolutionary affinities of the enigmatic saola (Pseudoryx nghetinhensis) in the context of the molecular phylogeny of Bovidae". Proceedings of the Royal Society B: Biological Sciences 266 (1422): 893. doi:10.1098/rspb.1999.0720. 
  16. ^ "Priorities for Success: 2nd Meeting of the Saola Working Group wraps up in Vietnam". IUCN. 
  17. ^ "Experts on the saola: The "Last chance" to save one of the world's rarest mammals". Scientific American. 

Resources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!