Overview

Brief Summary

Biology

Sumatran orang-utans are more sociable than their Bornean relatives, due in part to the mast fruiting of the fig trees, where large groups come together to feed (7). Orang-utans are long-lived and females tend to only give birth after they reach 15 years of age (2). The infant spends its first two to three years being carried constantly and will still remain close to the mother for at least another three years (7). The interval between births is the longest for any mammal and may be as long as eight years (4). Orang-utans move slowly through the trees, and will sway trees in order to cross larger gaps (7). Nights are spent in nests built high up in the canopy, constructed from branches and leaves (6). Because of increased availability, the diet of Sumatran orang-utans has a higher percentage of pulpy fruit and figs compared to that of Bornean orang-utans (7). Orang-utans are highly intelligent and some populations in Sumatra have learnt to use tools, passing this knowledge on through generations. Sticks are used to probe for termites in termite mounds or to extricate seeds from the large Neesia fruit, which has stinging hairs (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Orang-utan means 'person of the forest' (4) and this Asian ape is indeed truly arboreal. Recent genetic evidence has led to the re-classification of Bornean and Sumatran orang-utans as separate species: Pongo pygmaeus and Pongo abelii respectively (5). Orang-utans have distinctive body shapes with very long arms that may stretch as far as two metres. They have a coarse, shaggy reddish coat (6) and grasping hands and feet (2). Orang-utans are highly sexually dimorphic, with adult males being distinguished by their size, throat pouch and flanges either side of the face, known as cheek pads (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Pongo abelii is endemic to the island of Sumatra, Indonesia. It is generally restricted to the north of the island, north of the Batang Toru river on the west coast of North Sumatra province (Wich et al. 2003). It was once far more widespread and populations occurred as far south as Jambi and Padang up until at least the mid 1800s (see Rijksen 1978). There were reports of its existence in some parts of West Sumatra province as recently as the 1960s. However, surveys by Wich et al. (2003) found no evidence of their continuing survival south of the Batang Toru river.

The majority of wild Sumatran orangutans survive in the province of Aceh (more formally known as Nanggroe Aceh Darussalam, or NAD), at the northernmost tip of the island. There are populations within North Sumatra province, but the largest of these also straddles the border with Aceh. Only two potentially viable populations lie entirely within North Sumatra province: West Batang Toru and East Sarulla, both near, but south-west of lake Toba (for precise locations see Singleton et al. 2004).

Within Aceh, almost all remaining forest patches of any size still harbour orangutans at the lower altitudes, but there are few, if any reproducing populations in the large tracts of forest above 1,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Sumatran orangutans inhabit the island of Sumatra, in Indonesia. These orangutans have been restricted to the northern tip of Sumatra in fragmented forest. Logging has severely limited the range of this species.

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Evidence from the fossil record suggests that orang-utans were previously widespread throughout South East Asia. Today, however, the Sumatran orang-utan is found only in the north of this island in the Indonesian archipelago (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Sumatran orangutans are the largest non-human primates in Asia and the largest arboreal primates. They have long, fine red hair on their bodies and faces. Males have large cheek pads that are covered in a fine white hairs.The arm span, from finger tip to finger tip, is 2.25 m. The legs are small and weak compared to their muscular arms. There is sexual dimorphism between males and females. Female weights range from 30 to 50 kg and they can reach 1.3 m tall. Male weights range from 50 to 90 kg and reach a height of 1.8 m. Some old males may get too large to move around in trees easily and may have to resort to walking on the ground.

Sumatran orangutans may be distinguished from Bornean orangutans (Pongo pygmaeus) by their longer fur, more slender build, white hairs on the face and groin, and long beards on both males and females, but molecular characters are considered most definitive.

Range mass: 30 to 90 kg.

Range length: 1.3 to 1.8 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Sumatran orangutan is almost exclusively arboreal. Females virtually never travel on the ground and adult males do so only rarely. This is in contrast to Bornean orangutans (especially adult males) which more often descend to the ground. While both species depend on high-quality primary forests, Bornean orangutans appear better able to tolerate habitat disturbance. In Sumatra densities plummet by up to 60% with even selective logging (see Rao and van Schaik 1997).

Sumatran orangutans are primarily frugivores, but also eat leaves, insects (termites and ants) and on occasion, the meat of slow loris (Fox et al. 2004, Wich et al. 2006). Female home ranges are 800 to 1,500 ha. The true extent of male home range size is not fully known, although ranges in excess of 3,000 ha are inferred (Singleton and van Schaik 2001).

Females first give birth at about 15 years of age (Wich et al. 2004). Interbirth intervals are 8.2 to 9.3 years (compared with 6.1 to 7.7 years for P. pygmaeus; Wich et al. 2004, van Noordwijk and van Schaik 2005) and gestation lasts approximately 254 days (Kingsley 1981). Males exhibit bimaturism, whereby fully flanged adult males and the smaller unflanged males are both capable of reproducing, but employ differing mating strategies to do so (see Utami Atmoko et al. 2002). Longevity in the wild has been estimated at 58 years for males and 53 years for females (Wich et al. 2004).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sumatran orangutans are found in primary tropical lowland forests, including mangrove, swamp forests, and riparian forests. They live almost completely in the trees, building nests in which they nap or sleep for the night. Preferred elevations are 200 to 400 m, the area in which their preferred fruiting trees occur, but Sumatran orangutans can be found up to 1,000 to 1,500 m.

Range elevation: 200 to 1,500 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Wetlands: swamp

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits lowland tropical rainforests and swamps up to 800 meters above sea level (1) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Sumatran orangutan food choices vary seasonally. Most fruits are only available seasonally and within a limited range. Orangutans follow the fruiting season of local trees, feeding when they are ripe. Figs are one of the most important components of the Sumatran orangutan diet. During dry seasons, when fruit is less available, Sumatran orangutans will consume other vegetation. Fruit makes up about 60% of their diet, with the remainder being young leaves (~25%), flowers and bark (~10%), insects, mainly ants, termites, and crickets (~5%), and an occasional egg.

Animal Foods: eggs; insects

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Sumatran orangutans play a critical role in the lowland rainforests of Sumatra and are considered a keystone species. As widely ranging fruit eaters, orangutans are important in dispersing seeds and maintaining diversity of rainforest woody plants. They also prune and aid in regenerating plant growth because they only choose to eat green leaves and stalks.

Ecosystem Impact: disperses seeds; keystone species

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The primary predators currently of Sumatran orangutans are humans (Homo sapiens). Hunting of orangutans has decimated their populations. Natural predators of Sumatran orangutans are clouded leopards (Neofelis nebulosa) and Sumatran tigers (Panthera tigris sumatrae). These predator species are also under threat of extinction due to hunting by humans.

Known Predators:

  • MacKinnon, J. 1974. In Search Of The Red Ape. Ballantine Books; A Division of Random House, Inc. New York, NY: Holt, Rinehart and Winston.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Male Sumatran orangutans are capable of long, exceptionally loud calls (called "long calls") that carry through forests for up to 1 km. The "long call" is made up of a series of sounds followed by a bellow. These calls help males claim territory, call to females, and keep out intruding male orangutans. Males have a large throat sac that lets them make these loud calls. They may also pull small trees and limbs down to add a crashing sound along with the call. Sumatran orangutans vocalize with grunts, grumbles, and squeaks when they meet each other, and young orangutans squeak, bark and scream. Both adults and young make a variety of sounds with their lips and throats, including sucking, burping, and grinding their teeth.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Female life spans range from 44 to 53 years in the wild. There have been no reports documenting the onset of menopause and females seem to be capable of giving birth up to 51 to 53 years old. Male life spans are slightly longer, 47 to 58 years. Males are still considered healthy at these late ages by the tightness of their cheek pads and absence of bald spots. A captive female Sumatran orangutan lived to 55 years at the Miami Zoo.

Range lifespan

Status: wild:
44 to 58 years.

Range lifespan

Status: captivity:
55 (high) years.

Typical lifespan

Status: wild:
58 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The primary mating tactic involves "harassment" of female Sumatran orangutans by sub-adult males and adult males. Most harassment involves sub-adult males; females are less likely to mate with them, as compared to large adult males. Females are cornered by sub-adult males and may be raped by them; these sub-adult males may also take a female's young from her if they think it will make her more willing or available to mate.

Female orangutans have learned strategic ways to avoid or reduce harassment. The first method is a social tactic, where females form non-mating parties with adult male orangutans that reside in their area, reducing attacks from sub-adult males. Another is female-female bonding, where females alone form alliances to protect themselves against sub-adult males.

Harassment has also increased in the last decade due to habitat loss from illegal logging. More orangutans are forced into too small of an area, increasing agonistic interactions.

Mating System: polygynandrous (promiscuous)

Most mating occurs in the heaviest fruiting months. There is large variability in the amount of fruit from season to season. Highest fruiting periods happen during rainy seasons (December to May). Mast fruiting years, in which most of the trees of a single species fruit synchronously, occur every 2 to 10 years. Sumatran orangutan breeding is most intense in mast years. Any female who is not currently caring for offspring (pre-weaning) is available to mate. Females normally mate with the adult male whose large territory they live in, but chance encounters can happen in high fruiting seasons when many orangutans gather to feed. Females give birth to one young, twinning occurs rarely.

Adult female Sumatran orangutans become sexually active at the average age of 12.3 yrs and will produce their first offspring soon after. Male Sumatran orangutans are fully mature at an average age of 19 years.

Breeding interval: Interbirth intervals are 3 to 4 years.

Breeding season: Rainy seasons: December and May

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 227 to 275 days.

Average weaning age: 48 months.

Range time to independence: 8 to 9 years.

Average time to independence: 9.3 years.

Range age at sexual or reproductive maturity (female): 9 to 15.5 years.

Average age at sexual or reproductive maturity (female): 12.3 years.

Range age at sexual or reproductive maturity (male): 15 to 24 years.

Average age at sexual or reproductive maturity (male): 19 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

After a female orangutan has given birth, her next 8 to 9 years are devoted to her offspring's survival. Infant and juvenile orangutans must learn everything (feeding, social behaviors, etc.) from their mothers. Mothers provide young orangutans with food until they have learned to distinguish different types of food. Males do not play a role in offspring care. Once fully developed, a male will leave his mother to find his own territory. A developed, independent young female will either disperse or take up residence near her mother's territory.

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

  • Fox, E. 2002. Female tactics to reduce sexual harassment. Behavioral Ecology and Sociobiology, 52/2: 93-101.
  • Wich, S., S. Utami-Atmoko, T. Mitra Setia, H. Rijksen, C. Schürmann. 2004. Life history of wild Sumatran orangutans ( Pongo abelii ). Journal of Human Evolution, 47/6: 385-398.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pongo abelii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACCGCTGGCTATTCTCCACGAACCACAAAGACATCGGGACACTATACCTGTTATTCGGCGCATGGGCTGGAGTCCTAGGCACTGCCCTAAGCCTCCTCATTCGAGCTGAACTGGGCCAACCCGGCAACCTTCTAGGCAAT---GACCATATCTACAATGTCATCGTCACAGCTCATGCATTCGTAATAATTTTCTTTATAGTCATACCCATTATAATTGGAGGCTTTGGCAACTGACTAGTGCCCCTAATAATCGGCGCCCCCGATATAGCATTCCCGCGCATAAATAATATAAGCTTCTGACTCCTCCCCCCCTCCTTTCTCCTACTGCTCGCTTCTGCTACAGTAGAGGCTGGCGCAGGAACAGGCTGAACAGTCTATCCGCCCCTAGCAGGAAACTACTCTCACCCAGGAGCCTCTGTAGACTTAACAATCTTCTCTTTACACCTAGCAGGCATTTCCTCTATCCTAGGAGCTATCAATTTCATCACAACAATTATTAATATAAAACCCCCTGCAATATCCCAATACCAAACCCCCCTCTTCGTCTGATCAGTCTTGATCACAGCAGTCCTACTTCTCCTTTCCCTCCCAGTCCTAGCCGCTGGCATCACCATACTACTAACAGATCGCAACCTAAACACCACATTCTTTGACCCAGCCGGAGGTGGAGATCCCATCCTATATCAGCACCTATTCTGATTTTTTGGCCACCCTGAAGTCTACATTCTCATCCTGCCGGGTTTCGGCATAATCTCCCACATCGTAACACACTATTCCGGAAAAGAAGAGCCATTTGGGTACATAGGCATAGTCTGAGCCATAGTCTCAATTGGCTTCCTGGGCTTTATCGTATGGGCCCACCACATATTCACAGTAGGAATAGACGTGGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pongo abelii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Singleton, I., Wich, S.A. & Griffiths, M.

Reviewer/s
Mittermeier, R.A. & Williamson, E.A. (Primate Red List Authority)

Contributor/s

Justification
There has been an estimated decline of over 80% over the last 75 years (assuming a generation length of at least 25 years; Wich et al. in press). This decline continues, as forests within its range are under major threat. Most orangutans are outside of protected areas, including within potential logging areas and conversion forests. After a period of relative stability, pressure on these forests is increasing once again as a result of the recent peace accord, and a dramatic increase in demand for timber and other natural resources after the December 2004 tsunami.

History
  • 2007
    Critically Endangered
  • 2000
    Critically Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Critical orangutan habitat is rapidly being lost through illegal and legal logging in Sumatra. Their habitat has decreased over 80% in the last 20 years. Hunting orangutans for meat and killing adult females to obtain infants for the illegal pet trade has also caused an estimated decline in the orangutan population of 30 to 50% in the last 10 years. Uncontrolled forest fires have also harmed orangutan habitat.

US Federal List: endangered

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The most recent estimate for Pongo abelii is around 7,300 (Singleton et al. 2004), occupying forests that cover 20,552 km², but of which only those regions below 1,000 m asl (circa 8,992 km²) harbour permanent orangutan populations. Each population listed in Table 1 is considered to comprise a single contiguous population, but increasing fragmentation may result in further subdivisions in the near future. All except Seulawah have been adopted by the UNEP/UNESCO GRASP (Great Ape Survival Programme: see Caldecott and Miles 2005) initiative as priority populations for conservation. A few small fragments of forest outside of those listed may still contain small numbers of orangutans but none are considered viable in the long term. (See supporting documentation).

Follow the link below for Table 1: Pongo abelii populations.

In addition to the above, original wild populations, a new population is being established in the Bukit Tigapuluh National Park (Jambi and Riau Provinces) via the re-introduction of confiscated illegal pets. This population currently numbers around 70 individuals and is reproducing.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is seriously threatened by logging (both legal and illegal), wholesale conversion of forest to agricultural land and oil palm plantations, and fragmentation by roads. Animals are also illegally hunted and captured for the international pet trade but this appears to be more a symptom of habitat conversion, as orangutans are killed as pests when they raid fruit crops at the forest edge.

A new threat is the Ladia Galaska road network in Aceh province, which if legitimized by the government will rapidly fragment most of the populations listed above. Another major concern is the re-issuing of logging permits for large tracts of forest in Aceh.

An assessment of forest loss in the 1990s concluded that forests supporting at least 1,000 orangutans were lost each year within the Leuser Ecosystem alone (van Schaik et al. 2001). These loss rates subsequently dropped dramatically during major civil conflict in the province, and the imposition of a moratorium on logging in Aceh. A peace deal negotiated in 2005 led to political stability and many new applications to open up logging concessions and palm oil estates in orangutan habitat.

In parts of North Sumatra orangutans are also still hunted on occasions for food.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Orang-utans were hunted relentlessly throughout the majority of their South East Asian range, their large size and slow movements making them easy targets for hunters (8). However, the main threat to orang-utans today is loss of habitat (7). In the past twenty years 80 percent of orang-utan habitat has been lost to illegal logging, gold mining and conversion to permanent agriculture, in particular, palm oil plantations. What is special about these animals is their unique vulnerability to exploitation. Much of this may be attributed to their extremely long inter-birth interval, typically eight years, making them the slowest breeding primates on earth (7). Forest fires raged through much of Borneo in 1997 and 1998 and it is estimated that around one third of the island's orang-utan population was lost at this time (8). Orang-utans that wander into palm oil plantations and other human-inhabited areas may also be captured for the illegal pet trade, although this is a by-product of shrinking habitat and not a main issue (7). Recent political instability in the region has caused an increase in illegal logging in protected areas, and an increase in the capture of infants for the illegal pet trade. The population of Sumatran orang-utans was reported to have fallen by 46 percent from 1992 to 1999 (1)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Pongo abelii is listed on Appendix I of CITES and is strictly protected under Indonesian domestic legislation (UU No 5/1990). Protection of large areas of primary forest below 1,000 m asl is needed to secure their long term future.

A major stronghold is the Leuser Ecosystem conservation area: 2.6 million ha supporting circa 75% of remaining Sumatran orangutans. The Leuser Ecosystem was inaugurated by Presidential Decree in 1998 and its conservation is called for in the Act of Parliament No 11/2006 concerning Governance in Aceh. Management of the Ecosystem does not exclude non-forest uses, but stresses the importance of sustainable management with conservation of natural resources as the primary goal. Within the Leuser Ecosystem is the designated 900,000 ha Gunung Leuser National Park, but this mountainous area supports only 25% of the orangutans. The Gunung Leuser National Park is also a Man and Biosphere reserve and part of the Tropical Rainforest Heritage of Sumatra World Heritage Cluster Site. Outside of the Leuser Ecosystem there are no other notable large conservation areas harbouring this species.

In the wake of the December 2004 tsunami, efforts are also underway to establish a second ?Ulu Masen? ecosystem along similar lines to Leuser, incorporating the North East and North West Aceh populations. However, this process is in its early stages and there are already threats to open at least four large logging concessions in this area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Sumatran orang-utan is fully protected by law in Indonesia and is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), which bans international trade in this species. The key to saving this species is protecting tracts of unexploited forest that are interconnected and contain sufficient habitat (8). A massive national park has been proposed in the north of Sumatra covering 25,000 square kilometres and encompassing the existing Gunung Leuser National Park. The Leuser ecosystem will play a key role in protecting important refuges of the critically endangered Sumatran rhino (Dicerorhinus sumatrensis), elephant (Elephas maximus sumatranus) and tiger (Panthera tigris sumatrae), as well as the orang-utan and numerous lesser-known species (8). Time is running out for the Asian ape however, and there are fears that at current rates of decline both the Sumatran and the Bornean orang-utan could be extinct in the wild by 2010 (8). Due to the large home ranges that these apes require it is the protection of habitat that will ensure that these beautiful and enigmatic 'people of the forest' survive into the next century (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative affects of orangutans on humans. They are susceptible to many of the same diseases as humans, and thus can carry and transmit them as well, including tuberculosis, meliodosis, influenza, cholera, and intestinal parasites.

Negative Impacts: injures humans (carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Sumatran orangutans are important in seed dispersal. The protected status of orangutans make them an umbrella species. As umbrella species, if orangutans are protected, so is the rainforest they inhabit and all of its associated biodiversity.

There is still an active illegal trade in orangutans as pets.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sumatran orangutan

The Sumatran orangutan (Pongo abelii) is one of the two species of orangutans. Found only on the island of Sumatra, in Indonesia, it is rarer than the Bornean orangutan.

Physical description[edit]

The Sumatran orangutan grows to about 1.4 m (4.6 ft) tall and 90 kg (200 lb) in males. Females are smaller, averaging 90 cm (3.0 ft) and 45 kg (99 lb). Compared to the Bornean species, Sumatran orangutans are thinner and have longer faces; their hair is longer with a paler red color.[3]

Behaviour and ecology[edit]

Sumatran Orangutan at Bukit Lawang

Compared with the Bornean orangutan, the Sumatran orangutan tends to be more frugivorous and especially insectivorous.[4] Preferred fruits include figs and jackfruits. It will also eat bird eggs and small vertebrates.[5] Sumatran orangutans spend far less time feeding on the inner bark of trees.

Wild Sumatran orangutans in the Suaq Balimbing swamp have been observed using tools.[6] An orangutan will break off a tree branch that is about a foot long, snap off the twigs and fray one end. It then will use the stick to dig in tree holes for termites. They will also use the stick to poke a bee's nest wall, move it around and catch the honey. In addition, orangutans use tools to eat fruit. When the fruit of the Neesia tree ripens, its hard, ridged husk softens until it falls open. Inside are seeds that the orangutans enjoy eating, but they are surrounded by fiberglass-like hairs that are painful if eaten. A Neesia-eating orangutan will select a five-inch stick, strip off its bark, and then carefully collect the hairs with it. Once the fruit is safe, the ape will eat the seeds using the stick or its fingers. Although similar swamps can be found in Borneo, wild Bornean orangutans have not been seen using these types of tools.

NHNZ filmed the Sumatran orangutan for its show Wild Asia: In the Realm of the Red Ape; it showed one of them using a simple tool, a twig, to pry food from difficult places. There is also a sequence of an animal using a large leaf as an umbrella in a tropical rainstorm.

The Sumatran orangutan is also more arboreal than its Bornean cousin; this could be because of the presence of large predators like the Sumatran Tiger. It moves through the trees by quadrumanous locomotion and semibrachiation.

Life cycle[edit]

The Sumatran orangutan is more social than its Bornean counterpart; groups gather to feed on the mass amounts of fruit on fig trees. However, adult males generally avoid contact with other adult males. Subadult males will try to mate with any female, though they probably mostly fail, since mature females are easily capable of fending them off. Mature females prefer to mate with mature males. Male Sumatran orangutans sometimes have a delay of many years in the development of secondary sexual characteristics, such as cheek flanges and muscle mass.[7]

The average interbirth rates for the Sumatran orangutan is 9.3 years, the longest reported among the great apes, including the Bornean orangutan. Infant orangutans will stay close to their mothers for up to three years. Even after that, the young will still associate with their mothers. Both orangutan species are likely to live several decades; estimated longevity is more than 50 years. The average of the first reproduction of P. abelii is around 15.4 years old. There is no indication of menopause.[4]

Nonja, thought to be the world's oldest in captivity or the wild at the time of her death, died at the Miami MetroZoo at the age of 55.[8]

Conservation status[edit]

A Sumatran orangutan at Bukit Lawang

The Sumatran orangutan is endemic to Sumatra island and is particularly restricted to the north of the island. In the wild, Sumatran orangutans survive in the province of Nanggroe Aceh Darussalam (NAD), the northernmost tip of Sumatra.[9] The primate was once more widespread, as they were found more to the south in the 19th century such as in Jambi and Padang.[10] There are small populations in the North Sumatra province along the border with NAD, particularly in the Lake Toba forests. A survey in the Lake Toba region found only two inhabited areas, Bukit Lawang (defined as the animal sanctuary) and Gunung Leuser National Park.[11] The species has been assessed as critically endangered on the IUCN Red List since 2000.[2] It is considered one of "The World's 25 Most Endangered Primates."[12]

A survey in 2004 estimated that around 7,300 Sumatran orangutans still live in the wild.[9] Some of them are being protected in five areas in Gunung Leuser National Park; others live in unprotected areas: northwest and northeast Aceh block, West Batang Toru river, East Sarulla and Sidiangkat. A successful breeding program has been established in Bukit Tiga Puluh National Park in Jambi and Riau provinces. The main reason for the endangerment of these orangutans is because of palm oil companies destroying the native rain forests.

Genomics[edit]

Genomic information
NCBI genome ID325
Ploidydiploid
Genome size3,441.24 Mb
Number of chromosomes24 pairs
Year of completion2011

Orangutans have 48 chromosomes.[13] The Sumatran orangutan genome was sequenced in January 2011, based on a captive female named Susie.[14] Following humans and chimpanzees, the Sumatran orangutan has become the third extant hominid[15] species to have its genome sequenced.[14][16]

The researchers also published less complete copies from 10 wild orangutans, five from Borneo and five from Sumatra. The genetic diversity was found to be lower in Bornean orangutans (Pongo pygmaeus) than in Sumatran ones (Pongo abelii), despite the fact that Borneo is home to six or seven times as many orangutans as Sumatra. The comparison has shown these two species diverged around 400,000 years ago, more recently than was previously thought. The orangutan genome also has fewer rearrangements than the chimpanzee/human lineage.[14] The full sequence and annotation can be viewed on the Ensembl Genome Browser.

See also[edit]

References[edit]

  1. ^ Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ a b Singleton, I., Wich, S. A. & Griffiths, M. (2008). Pongo abelii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ Primate Info Net: Orangutan Pongo
  4. ^ a b S. A. Wich; S. S. Utami-Atmoko; T. M. Setia; H. D. Rijksen; C. Schürmann, J.A.R.A.M. van Hooff and C. P. van Schaik (2004). "Life history of wild Sumatran orangutans (Pongo abelii)". Journal of Human Evolution 47 (6): 385–398. doi:10.1016/j.jhevol.2004.08.006. PMID 15566945. 
  5. ^ "Science & Nature - Wildfacts - Sumatran orangutan". BBC. Retrieved 2009-07-03. 
  6. ^ Zimmer, Carl. "Tooling through the trees - tool use by wild orangutans" Discover Magazine, November 1995.
  7. ^ Pradhan, Maria A. van Noordwijk1, Carel van Schaik1, 2012A model for the evolution of developmental arrest in male orangutans
  8. ^ "'World's oldest' orang-utan dies". BBC News. 31 December 2007. 
  9. ^ a b Singleton, I., S. Wich, S. Husson, S. Stephens, S. Utami Atmoko, M. Leighton, N. Rosen, K. Traylor-Holzer, R. Lacy, O. Byers (2004). "Orangutan Population and Habitat Viability Assessment". Final Report. IUCN/SSC Conservation Breeding Specialist Group (CSG). IUCN. 
  10. ^ Rijksen, H. D. (1978). "A Field Study on Sumatran Orang utans (Pongo pygmaeus abelli, Lesson 1827)". Ecology, Behavior and Conservation (Wageningen: Veenaman and Zonen). 
  11. ^ S. A. Wich; I. Singleton; S. S. Utami-Atmoko; M. L. Geurts; H. D. Rijksen; and C. P. van Schaik (2003). "The status of the Sumatran orang-utan Pongo abelii: an update". Flora & Fauna International 37 (1): 49. doi:10.1017/S0030605303000115. 
  12. ^ Mittermeier, R.A.; Wallis, J.; Rylands, A.B.; Ganzhorn, J.U.; Oates, J.F.; Supriatna, E.A.; Palacios, E.; Heymann, E.W.; Kierulff, M.C.M., eds. (2009). Primates in Peril: The World's 25 Most Endangered Primates 2008–2010 (PDF). Illustrated by S.D. Nash. Arlington, VA.: IUCN/SSC Primate Specialist Group (PSG), International Primatological Society (IPS), and Conservation International (CI). pp. 1–92. ISBN 978-1-934151-34-1. 
  13. ^ Sharshov, Alexander. "New Page 1". SB RAS Novobrisk. Institute of Cytology and Genetics. Retrieved 28 January 2011. 
  14. ^ a b c Singh, Ranjeet (26 January 2011). "Orang-utans join the genome gang". Nature. doi:10.1038/news.2011.50. Retrieved 2011-01-27. 
  15. ^ Spencer, Geoff (26 January 2011). "NIH-funded scientists publish orangutan genome sequence". National Institutes of Health News. U.S. Department of Health and Human Services. Retrieved 28 January 2011. 
  16. ^ Cohen, Jon (26 January 2011). "Orangutan Genome Full of Surprises". Science Now. American Association for the Advancement of Science. Retrieved 28 January 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!