Overview

Brief Summary

Onchocerca volvulus is one of the eight parasitic nematode (roundworm) species that account for most cases of filariasis in humans. This form of filariasis is known as onchocerciasis, or river blindness. Onchocerca volvulus is one of the three of these eight species responsible for most of the morbidity attributable to filariasis (the other two being Wuchereria bancrofti and Brugia malayi, which cause lymphatic filariasis). Onchocerca volvulus occurs mainly in Africa, with additional foci in Latin America and the Middle East. (Centers for Disease Control Parasites and Health website)

During a blood meal, an infected Simulium blackfly introduces Onchocerca volvulus third-stage filarial larvae onto the skin of the human host, where they penetrate into the bite wound. In subcutaneous tissues, the larvae develop into adult filariae (a slow process than can require up to 18 months), which commonly reside in nodules in subcutaneous connective tissues. Adults can live in the nodules for around 15 years. Some nodules may contain numerous male and female worms. Females measure 33 to 50 cm in length and 270 to 400 μm in diameter, while males measure 19 to 42 mm by 130 to 210 μm. In the subcutaneous nodules, the female worms are capable of producing microfilariae for approximately 9 years. The microfilariae, measuring 220 to 360 µm by 5 to 9 µm and unsheathed, have a life span that may reach 2 years. They are occasionally found in peripheral blood, urine, and sputum, but are typically found in the skin and in the lymphatics of connective tissues and can invade the eyes. A blackfly ingests the microfilariae during a blood meal. After ingestion, the microfilariae migrate from the blackfly's midgut through the hemocoel to the thoracic muscles. Over the next one to two weeks, the microfilariae develop into first-stage larvae and subsequently into third-stage infective larvae. The third-stage infective larvae migrate to the blackfly's proboscis and can infect another human when the fly takes a blood meal. (Centers for Disease Control Parasites and Health website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Onchocerca volvulus can be found mainly in West Africa, and also in Central and South America. Most likely, this species was originally only in Africa, and was introduced to the Americas with African slaves. There are two strains of this species, distinguishable at the DNA level by the O-150 PCR test. One strain is typically found in the savanna regions of West Africa and the Americas, while the other strain is commonly found in rain forest areas.

Biogeographic Regions: ethiopian ; neotropical

  • Ogunrinade, A., D. Boakye, A. Merriweather, T. Unnasch. 1999. Distribution of the Blinding and Non-blinding Strains of Onchocerca volvulus in Nigeria. The Journal of Infectious Diseases, 179: 1577-1579.
  • Roberts, L., J. Janovy, Jr. 2000. Foundations of Parasitology, Sixth Edition. New York: Mc Graw Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adults of Onchocerca volvulus are long and slender, have a smooth cuticle, and have blunt anterior and posterior ends. There are no lips or buccal capsule, and the mouth is surrounded by 2 circles made up of four papillae each. The esophagus doesn't appear to be divided. Males range in length from 19-42 cm and range in width from 130-210 micrometers. Lacking alae, their tails are curled ventrally and bear 6 or 8 pairs of postanal and 4 pairs of adanal papillae. Females are larger than males, ranging in length from 33.5-50 cm and in width from 270-400 micrometers. Their vulva is directly behind the posterior end of the esophagus. The microfilariae released by adult females are 250-300 micrometers long, are unsheathed, and have sharply pointed and curved tails.

Range length: 19 to 50 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The habitat of Onchocerca volvulus is the body of its host. In the blackfly, microfilariae reside in the thoracic flight muscles. In humans, microfilariae can be found in the skin, lymph vessels, lymph nodes, blood, urine, cerebrospinal fluid, and internal organs (especially the eyes). Adults can be found knotted together in pairs or groups in the subcutaneous tissues. Due to host immunological reactions, these groups of worms often become encapsulated in fibrous tissue mainly composed of collagen. When these sites are located over bones such as a joint or skull, a conspicuous nodule called an onchocercoma appears, which is generally about 3 cm in diameter. Nodule location depends on geographical area, with most infections in Africa exhibiting nodules below the waist (especially on the knees and pelvic area), and those in Central America exhibiting nodules above the waist (especially on the neck and head). This relationship is based on the biting preferences of the blackfly vector, with African flies preferring to bite below the waist, and Central American flies preferring to bite above the waist.

Onchocerca volvulus will generally be found causing disease in savanna and rain forest areas, although occasionally it can be found in arid savannas and desert areas as well.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest

Aquatic Biomes: rivers and streams

Wetlands: marsh ; swamp

Other Habitat Features: riparian

  • Burnham, G. 1998. Onchocerciasis. Lancet, 351: 1341-1346.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Adults receive nutrients either from ingesting blood, or from absorption via a highly convoluted cuticle. It is common for rich vascular networks to develop surrounding groups of worms (the worms probably stimulate vessel formation), and these vessels bring the worms in close proximity with blood and nutrients.

Animal Foods: blood; body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Onchocerca volvulus has a complex life cycle involving a definitive and intermediate host. The only natural definitive host is humans. The intermediate host is a blackfly in the genus Simulium. Common blackfly hosts include Similium damnosum and S. neavei in Africa and S. ochraceum, S. metallicum, S. callidum, and S. exiguum in the Americas.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

These animals are probably not preyed on directly but are ingested. Egg and larval mortality are high since the parasites often do not reach appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Nematodes in general have papillae, setae and amphids as the main sense organs. Setae detect motion (mechanoreceptors), while amphids detect chemicals (chemoreceptors). When mating, females may produce a pheromone to attract males.

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Onchocerca volvulus has a complex life cycle involving a definitive and intermediate host. The only natural definitive host is humans. The intermediate host is a blackfly in the genus Simulium. Common blackfly hosts include Similium damnosum and S. neavei in Africa and S. ochraceum, S. metallicum, S. callidum, and S. exiguum in the Americas. Adult worms typically live from 8-15 years in human hosts, and microfilariae can live up to 2 years. Adults can be found grouped together in various regions of the human body, with groups containing about half as many males as females. The males move from group to group, inseminating the females. Fertilized eggs develop into live microfilariae in 3-12 weeks, and the females release the microfilariae into the host body. A single female worm may release 1300-1900 microfilariae per day for 9-11 years. The microfilariae migrate away from the adult worms, through blood vessels, lymphatics, skin and connective tissue, and generally settle in the skin.

Since the mandibles of the blackfly are not useful for deep piercing, a blackfly feeding on an infected human host will ingest blood and tissue fluid containing microfilariae. Once ingested, the microfilariae are attracted to the fly's thoracic flight muscles, and travel there. In 6-12 days, the microfilariae then develop into juvenile stage 1 (J1), molt into juvenile stage 2 (J2), and molt into juvenile stage 3 (J3), which is the infective, filariform stage. J3 worms then migrate to the labium of the blackfly host, and can infect new human hosts when the female fly next feeds on blood. Upon gaining entry into a human host, the J3 worms develop into adults in 1-3 months. After initial infection, microfilariae from the adults will appear in 10-20 months.

  • Richards, F., D. Hopkins. 2000. Programmatic Goals and Approaches to Onchocerciasis. Lancet, 355: 1663-1664.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Adult worms typically live from 8-15 years in human hosts, and microfilariae can live up to 2 years. Adults can be found grouped together in various regions of the human body, with groups containing about half as many males as females. The males move from group to group, inseminating the females.

Females may produce a phermomone to attract males. The male coils around a female with his curved area over the female genital pore. The gubernaculum, made of cuticle tissue, guides spicules which extend through the cloaca and anus. Males use spicules to hold the female during copulation. Nematode sperm are amoeboid-like and lack flagella.

Fertilized eggs develop into live microfilariae in 3-12 weeks, and the females release the microfilariae into the host body. A single female worm may release 1300-1900 microfilariae per day for 9-11 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

There is no parental investment beyond the time the female releases the microfilariae.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Barnes, R. 1987. Invertebrate Zoology. Orlando, Florida: Dryden Press.
  • Burnham, G. 1998. Onchocerciasis. Lancet, 351: 1341-1346.
  • Richards, F., D. Hopkins. 2000. Programmatic Goals and Approaches to Onchocerciasis. Lancet, 355: 1663-1664.
  • Roberts, L., J. Janovy, Jr. 2000. Foundations of Parasitology, Sixth Edition. New York: Mc Graw Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Onchocerca volvulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTTTGTGGAATGACTTTTGGCAATAGTATGAAGCAGAGTATTATTAATACTGTGAATCATAAGACTATTGGTACTTATTATATTGTTTTAGGCTATTGGGCTGGTTTAGGTGGTTCTGTTTTATCTATGTTGATTCGTTTTGAGTTGTCTAGTCCTGGTGGTCATTTGTTTTTTGGAAGTGGTCAGGTTTATAATTCTGTTCTTACTATGCATGGTGTTTTGATGATTTTTTTTTTAGTTATGCCTATTTTGATTGGTGGTTTTGGTAATTGGATGTTGCCTTTGATGTTGGGGGCTCCTGAGATGGCGTTTCCTCGGGTAAATGCTTTATCTTTTTGGTTTACTTTTGTGGCTTTATTGATAGTTTATCAGTCTTTTTTTATTGGGGGTGGTCCTGGTAGGAGTTGGACTTTTTATCCTCCTCTTAGGGTTGAAGGTCAACCAGAATTGTCTTTAGATACTATGATTTTAGGTTTACATACTGTAGGAATTGGTTCTTTGTTGGGTGCTATTAATTTTATGGTAACTACTCAGAATATACGGTCTACTGCTGTGACTTTGGATCAAATTAGTATGTTTGTTTGGACTTCTTATTTGACTTCTTTTTTATTAGTTTTATCTGTGCCTGTTTTGGCTGGTTCTTTATTGTTTTTGTTGTTGGATCGTAATTTTAATACTTCTTTTTATGATACTAAGAAGGGGGGTAATCCTTTGTTGTATCAGCATTTGTTTTGATTTTTTGGTCATCCTGAGGTGTATGTTATTATTTTACCTGTTTTTGGTATTATTAGGGAGGCTGTTTTATTTTTGACTGATAAGGATCGTTTGTTTGGTCAGACTAGGATGACTTTTGCTTCTATTTGGATTGCTGTTTTAGGTACTTCTGTATGGGGCCATCATATGTATACGGCTGGTTTGGATATTGATACTCGTACTTATTTTAGTGCTGCTACTATGATTATTGCTATTCCTAGGGCTGTTAAGATTTTTAATTGATTGGGTACTTTTTTTGGTTCTAATCAAAAGATGCAGCCATTATGATGTTGAACTTATAGTTTTATTTTTCTTTTTACTGTGGGTGGATTAAGTGGAATTATTTTGAGGGCTGCTAGTTTGGATATTATTTTGCATGATACTTATTATGTTGTGGCTCATTTTCATTATACTTTGAGTTTGGGTGCTATTTATGGTATTTTTTGTGGTTTTTGTTTGTGACTTCCTTATATGTACGGTATTTCTTTTGATAGGGTTATGATAATAGCTGTTTTTGTTTGTTTTTTTGTTGGTACTAATATAACGTTTTTTCCTATGCATTTTGCTGGTTTACAGGGTATGCCTCGTAAGATTTTGGATTATCCTGATTGTTATTCTACTTTTCAAATCATTTCTTCTTTAGGTTCTGTTATTACTTTTGTTGGTTTTGTTTTGTTTAATTATTTGTTGATTGATTCTATTTTTTTTTCTCGTTTTTTGGGAGTTTCTTTTTATAATTATCATAGTCCGGCTTATGCTTTAAATGTTCCTCCTTTGCCGGATTCTTTTACTGAAGAGGCTTTTATTATAGGTCTCCATTGGAAGATTATTAGTAAGGATACTCCTTCTTACAGTTATCGTCGGGTTGGTTATGGTTATCATAGTAAGTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Onchocerca volvulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Onchocerca volvulus is the pathogen responsible for the disease onchocerciasis, or river blindness. Infecting at least 17.7 million people worldwide, this non-fatal but severely debilitating disease is endemic in 37 countries (30 in Africa, 6 in the Americas, and Yemen). The pathology of onchocerciasis is based on host immune responses to the adult worm and the microfilariae, with the microfilariae being much more immunogenic. Little inflammation is caused by live microfilariae, but dead and degenerating microfilariae in the skin cause severe dermatitis, intense itching, skin depigmentation, skin thickening, skin discoloration, cracking of skin, and loss of skin elasticity. Quite often, microfilariae migrate to the eye, and their death causes intense inflammation. Over years this sclerosing (scarring) keratitis hardens the cornea and causes blindness. Worldwide, onchocerciasis impairs the vision of 500,000 people, and causes complete blindness in another 270,000. In some communities, the frequency of visual impairment is as high as 30%, and the frequency of blindness can be more than 10%. Additionally, elephantiasis may result (from microfilarial infestation of the lymphatic system), along with associated hernias. Furthermore, this disease results in decreased worker productivity, and the skin disfiguration can reduce marital prospects, reduce dowry size, and disrupt social relationships.

Negative Impacts: injures humans (causes disease in humans )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

none

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Onchocerca volvulus

Onchocerca volvulus is a nematode that causes onchocerciasis or "river blindness" mostly in Africa. Long-term corneal inflammation, or keratitis, leads to thickening of the corneal stroma which ultimately leads to blindness. Humans are the only definitive host for O. volvulus. The intermediate host or vector is the black fly (Simulium).

O. volvulus, along with most filarial nematodes, share an endosymbiotic relationship with the bacterium Wolbachia. In the absence of Wolbachia, larval development of the O. volvulus is disrupted or ceased.

The life cycle of O. volvulus

The life cycle of O. volvulus begins when a parasitised female black fly of the genus Simulium takes a blood meal. The microfilariae form of the parasite found in the dermis of the host is ingested by the black fly. Here the microfilariae then penetrates the gut and migrates to thoracic flight muscles of the black fly, entering its first larval phase (J1). After maturing into J2, the second larval phase, it migrates to the proboscis where it can be found in the saliva. Saliva containing stage three (J3S) O. volvulus larvae passes into the blood of the host. From here the larvae migrate to the subcutaneous tissue where they form nodules and then mature into adult worms over a period of six to twelve months. After maturation, the smaller adult males migrate from nodules to subcutaneous tissue where they mate with the larger adult females, which then produce between 1,000 and 3,000 microfilariae per day. The normal adult worm lifespan is up to fifteen years. The eggs mature internally to form stage one microfilariae, which are released from the female's body one at a time and remain in the subcutaneous tissue.

These stage one microfilariae are taken up by black flies upon a blood meal, in which they mature over the course of one to three weeks to stage three larvae, thereby completing the life cycle.

The normal microfilariae lifespan is 1–2 years; however, their presence in the bloodstream causes little or no immune response until death or degradation of the microfilariae or adult worms.

See also[edit]

References[edit]

  • Saint Andre, A., Blackwell, N., Hall, L. (2002.) The Role of Endosymbiotic Wolbachia Bacteria in the Pathogenesis of River Blindness. Science 295, 1892. Retrieved 2009- 11-11.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!