Overview

Distribution

Range Description

The large-antlered muntjac is only known from the Annamite mountain chain and associated hill ranges of Lao PDR, Viet Nam and, marginally, eastern Cambodia. All current records from Cambodia, like most from Lao PDR and Viet Nam, are trophy antlers held by local hunters (R.J. Timmins pers. comm. 2006). Large-antlered Muntjac do not inhabit the northern highlands of Lao PDR or Viet Nam, nor the Mekong plain. Its distribution and status in Lao PDR was reviewed by Timmins et al. (1998), but no comparable compilation is available for Viet Nam. There have been no significant extensions of known Lao range since this collation.

In neither Lao PDR nor Viet Nam is there any marked discontinuity in landforms between the Annamite range and the northern highlands. Large-antlered Muntjac seems not to extend into the latter region as defined in Baltzer et al. (2001). Its trophies have been reported furthest to the north-east from the Pu Huong Nature Reserve, Nghe An province (Cao Tien Trung and A. Grieser Johns pers. comm. to R.J. Timmins 2008). Searches further north in Viet Nam have not found the species (e.g. Le Trong Trai et al. 1999c; Le Trong Trai and Do Tuoc pers. comm. to R.J. Timmins in the 1990s). The most northerly evidence in the main Annamite spine is from Pu Mat Nature Reserve, Nghe An Province, on the Viet Namese side and from southern Bolikhamxai on the Lao side, with presence also to the west in southern Nam Kading National Protected Area (NPA) (Schaller and Vrba 1996; Timmins et al. 1998; SFNC 2000; R.J. Timmins pers. comm. 2008). In Lao PDR, the species might yet be found as far north as southern Xiangkhouang Province and Xaisomboun Special Administrative Zone, which remain largely unsurveyed, as does most of intervening northern Bolikhamxai Province.

South of southern Bolikhamxai Province and southern Nam Kading NPA in Lao PDR, the Large-antlered Muntjac occurs in the Annamites, particularly Nakai–Nam Theun NPA and the Nakai plateau, and outlying hill ranges including the foothills in and around Phou Xang He NPA, Xe Bang-Nouan NPA and Dong Phou Vieng NPA, the Lao–Viet Namese border area in the region of Hin Namno NPA, and the main body of the central Annamites in Xe Sap NPA, the Dakchung Plateau and Dong Ampham NPA (Schaller and Vrba 1996, Davidson et al. 1997; Timmins et al. 1998; Steinmetz 1998; Steinmetz et al. 1999; Robichaud et al. in prep.).

In Viet Nam, south of Pu Mat Nature Reserve, the Large-antlered Muntjac has been recorded in several Annamite sites including Vu Quang Nature Reserve, Ha Tinh Province (Dawson and Do Tuoc 1997; Eve et al. 2001: 45 and 122). From Vu Quang NR southwards, there are, as in Lao PDR, sporadic records of trophies, but little other information save for anecdotal reports of the species’s scarcity (Le Xuan Canh et al. 1997; Le Trong Trai and Richardson 1999; Le Trong Trai et al. 1999a, 1999b, 2001; Timmins et al. 1999; Timmins and Trinh Viet Cuong 2001; Le Manh Hung et al. 2002; Tua Tien Hue Province Forest Protection Department; Tua Tien Hue and Quang Nam Provinces: B. Long; Kon Plong area, Kontum Province: Do Tuoc; A Loui District, Quang Nam Province and Kon Cha Rang NR area, Gia Lai province: Le Trong Trai; all pers. comm. to R.J. Timmins). In the mid 1990s the Forest Inventory and Planning Institute and the Institute of Ecology and Biological Resources obtained two and three, respectively, freshly hunted animals from the Lam Ha District, Lam Dong Province in the Southern Annamites (a region often referred to as the Langbian or Dalat Plateau), which they mounted as specimens for the respective institutions (Do Tuoc and Pham Trong Anh pers. comm. to RJT). The Da Lat Biology Institute in Lam Dong in October 1995 held 19 M. vuquangensis, reportedly mostly from some or all of the districts of Lac Duong, Di Linh, Bao Loc and Lam Ha (Pham Trong Anh et al. 1996). This area is also one of the few with reasonable historical evidence for Large-antlered Muntjac (Millet 1930; Bauer 1997). No published recent survey has determined the conservation status of the Large-antlered Muntjac in this area, and its southern limit remains poorly known.

In Cambodia, the Large-antlered Muntjac is known only through trophy antlers seen in villages and markets of the Mondulkiri plateau (Desai and Lic 1996; Timmins and Ou 2001; Walston 2001). It is probably very localised: extensive camera-trapping at low elevations on the southern slope in Siema Biodiversity Conservation Area has not detected the species (J.L. Walston and T.D. Evans pers. comm. to R.J. Timmins based on WCS unpublished data), and at higher elevations closed canopy semi-evergreen forest forms a mosaic with deciduous forests, savanna and grassland; the latter are believed to be unsuitable for the species (Timmins and Ou 2001; R.J. Timmins pers. comm. 2008). Slight doubt over provenance of trophies in Mondulkiri reflects the heavy trade with Viet Nam (albeit mostly to Viet Nam from Cambodia) and lack of influence on hunters’ movements of the international border. On ecological grounds there seems little question that this muntjac should occur in Cambodia, although it may already have been hunted out.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Giant muntjacs were first recorded in 1994 in the Vu Quang Nature Reserve located in the Ha Tinh Province of north central Vietnam. They are primarily found in the Annamite Mountains on the border of Vietnam and Laos, although the species has also been found in the Mondulkiri province of Cambodia, and in Annam, as far south as the Dalat Plateau. Along the mountains, antlers of giant muntjacs have been found in villages as far north as the Chat River and as far south as the village of Dakchung, although the true extent of its range is still unknown.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Bauer, K. 1997. Historic record and range extension for giant muntjac, Muntiacus vuquangensis (Cervidae). Mammalia, 61/2: 265-267.
  • Schaller, G., E. Vrba. 1996. Description of the giant muntjac (Megamuntiacus vuquangensis) in Laos. Journal of Mammalogy, 77/3: 675-683.
  • Timmins, R., T. Evans, K. Khounboline, C. Sisomphone. 1998. Status and conservation of the giant muntjac Megamuntiacus vuquangensis, and notes on other muntjac species in Laos. Oryx, 32/1: 59-67.
  • Massicot, P. 2003. "Giant Muntjac" (On-line). Animal Info Pages. Accessed April 08, 2004 at http://www.animalinfo.org/species/artiperi/megavuqu.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Giant muntjacs range in weight from 30 to 50 kg, with males typically being larger than females. The fur is agouti brown and becomes darker toward the back. The limbs are dark brown to blackish. The fur on the belly, the inside of the legs, the anal area, and the underside of the tail is white. Male fur has been noted to become darker in December and January as antler growth stops and velvet dries. The tail of giant muntjacs is relatively short and triangle-shaped. Males have large canine teeth that project from the upper jaw.

Antlers in males are larger than those of any other muntjac. They grow up and backward, with forking that creates a brow tine. Measured antlers had bean lengths of 17.0 to 28.5 cm and the brow tines were up to 9.8 cm long. The pedicels are very prominent and extend along the face as ridges.

Although the general dimensions of giant muntjacs are not unique, there are four features that separate these animals as a species: short/stout pedicels, size and conformation of antlers, skull characteristics (length and shape of nasals), and a triangular tail.

Range mass: 30 to 50 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The habitat preferences of the Large-antlered Muntjac remain unclear. Its global distribution is similar to better-understood species such as Crested Argus Rheinardia ocellata and Red-shanked Douc Pygathrix nemaeus, suggesting that it is tied to the evergreen and semi-evergreen forests characteristic of the Annamites, and cannot use the climatically drier hill semi-evergreen forests further north and west. But paradoxically, it is not now common in the ‘ever-wet’ eastern slopes of the Northern and Central Annamite ranges. Perhaps, as is strongly suspected with Red-shanked Douc, substantial population losses have resulted from very high hunting pressure in such regions. While such a proposition is consistent with the apparent decline at Vu Quang Nature Reserve during the 1990s as discussed in Eve et al. (2001: 45 and 122; see above, under Population), there is no real evidence for it, although information from villagers in Viet Nam does suggest such a pattern (B. Long pers. comm. 2008). An intrinsic sub-optimality of closed-canopy ever-wet forest cannot yet be ruled out. Both the areas for which there is reasonable evidence for relatively high abundance, the Nakai Plateau and adjacent areas of Nakai–Nam Theun NPA, and the Lam Dong Province, are both a rather heterogeneous mosaic of habitats, with extensive areas not supporting closed-canopy forest (based on historical rather than recent disturbance). Although much of Annamite Lao PDR and Viet Nam could also be described as “a rather heterogeneous mosaic of habitats”, there are not many extensive such landscapes without high densities of human population and heavy fragmentation (R.J. Timmins pers. comm. 2008). Habitat in Vu Quang NR is more contiguous and primarily evergreen forest, climatically wetter than the above two areas; but at lower altitudes much of the forest is somewhat opened-up (R.J. Timmins pers. comm. 2008). Village interview data and camera-trapping in both Lao PDR and Viet Nam that suggest a lack of syntopy between the Large-antlered Muntjac and the Roosevelts' group, even though there is a wide sympatry (W.G. Robichaud pers. comm. 2008; B. Long pers. comm. 2008).

The Large-antlered Muntjac’s altitudinal range remains uncertain: hunting areas around most villages from which specimens come span a wide range. Interviews of villagers throughout Quang Nam, Hue and Quang Tri provinces, Viet Nam, all suggested that this muntjac does not live much above 900 m asl (B. Long pers. comm. 2008). The few real data available also suggest that it may live mostly below about 1,000 m asl (Timmins et al. 1998; Evans et al. 2000; Robichaud et al. in prep.), but localised higher occurrence in undulating plateaux, for example in the Southern Annamites of Cambodia and Viet Nam, would not be surprising (Bauer 1997; R.J. Timmins pers. comm. 2008). Altitudinal information needs evidence of its reliability: specifically, hunters’ statements of origins of skulls, no matter how certain-sounding, need to be taken carefully; often, hunters assertively associate skulls and lowerjaws as from one animal when tooth-wear patterns show that they must have come from different individuals (R.J. Timmins pers. comm. 2008).

The lack of precisely-located field records also hinders assessment of use of secondary habitats. As an ungulate dependent upon ground-level food (including fallen fruit, presumably, when available), densities would be expected to be higher in edge, broken and secondary areas than in closed-canopy tall evergreen forest.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The mountains where giant muntjacs are found are fairly rugged with a varying landscape of hills, plateaus, and valleys on the westward side. Their main habitat is old-growth broad-leaved evergreen forests with an understory of bamboo, palms, and tree saplings. These animals have also been seen in wet evergreen forests, dry evergreen forests, and mixed secondary forests of pine and evergreen. Altitudes for these habitats range from 500 to 1200 m. Local peoples say Muntiacus vuquangensis is scarcer in degraded habitats and can be moderately common, rare, or absent depending on the forests condition.

Range elevation: 1200 to 500 m.

Habitat Regions: terrestrial

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

No studies have been done on this aspect of the giant muntjac, yet the principal vegetation it is found in is broad-leaved evergreen forests with an understory of bamboo, palms, and tree saplings. The diets of other muntjacs include grasses, shoots, and low growing leaves that are still tender.

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

No documentation of the ecosystem roles of this species exists. However, as primary consumers, it is likely that they affect plant growth, and perhaps, as prey species, they affect population growth for predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Local people living in its range hunt the giant muntjac for its meat. An adult female was observed being attacked by an Asian dhole (Cuon alpinus) when local hunters killed it.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Muntiacus vuquangensis is prey of:
Homo sapiens
Cuon alpinus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

All muntjacs are known as barking deer because they make a noise very similar to a dog's bark when they sense danger. This bark may be used in identification of individuals. Other means of communication have not been documented in this species, although, as mammals, it is likely that they use visual signals, tactile information (especially between mothers and their young, as well as mates), and olfactory cues. Other members of the genus are known to use scent marks to define territories.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

No studies have been conducted on longevity in the giant muntjac, although the much smaller Reeve's muntjac is known to live up to and past 17 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Little is known about the reproductive cycle of giant muntjacs although females have only been observed with single young and a female killed on January 6 was carrying a 165 g fetus.

Other muntjacs are apparently polygynous, and it is likely that with the sexual dimorphism seen in this species, it is polygynous as well. In Muntiacus reevesi held in captivity, males formed a dominance heirarchy, and maintained exclusive home ranges, which they defended and scent marked. In feral populations in England, the approximately 20 ha home ranges of males of M. reevesi overlap with the smaller (12 ha) home ranges of females. This distribution might have reproductive significance.

Mating System: polygynous

Information on the reproduction of this species is not available. However, it is reasonable to assume that they are something like other members of the genus Muntiacus.

In the genus Muntiacus females are reported to be polyestrous, with a cycle ranging in length from 14 to 21 days. Of this time, they are probably in estrus only for about 2 days. Breeding can be seasonal or year round, depending on the climate. Gestations around 209-220 days have been reported, and the young of these animals are reported to be about 1 kg. However, the giant muntjac is much larger than other members of the genus, so the young may also be larger.

Breeding interval: These deer probably breed annually.

Breeding season: The breeding season for these animals is not known.

Average number of offspring: 1.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

No information is available on the parental behavior of these animals. However, within the genus Muntiacus, females typically give birth to young in the dense jungle, where they remain hidden until they can move around with their mothers. Male parental care has not been reported in this genus.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting); pre-independence (Protecting: Female)

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Schaller, G., E. Vrba. 1996. Description of the giant muntjac (Megamuntiacus vuquangensis) in Laos. Journal of Mammalogy, 77/3: 675-683.
  • Massicot, P. 2003. "Giant Muntjac" (On-line). Animal Info Pages. Accessed April 08, 2004 at http://www.animalinfo.org/species/artiperi/megavuqu.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Muntiacus vuquangensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTTTCAACTAATCATAAAGACATCGGTACCCTGTATCTATTATTTGGTGCCTGAGCAGGTATAGTAGGAACAGCCCTAAGCCTGTTAATTCGTGCTGAACTGGGTCAACCAGGGACCCTACTTGGAGATGACCAAATTTATAACGTAATTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCCATTATGATTGGAGGATTTGGCAATTGACTAGTCCCTTTAATAATTGGTGCTCCAGACATAGCATTTCCTCGAATAAATAATATAAGCTTCTGGCTTCTCCCACCCTCTTTCCTACTACTTCTAGCATCATCTATAGTTGAAGCTGGCGCAGGAACGGGCTGAACTGTATACCCCCCTCTAGCTGGTAATCTGGCCCATGCAGGAGCTTCAGTTGACCTGACTATTTTTTCTTTACACCTAGCAGGTGTTTCTTCAATTTTAGGGGCCATTAACTTTATTACAACAATTATTAATATAAAACCCCCTGCCATATCACAATACCAAACTCCCCTGTTCGTGTGATCCGTACTAATTACCGCCGTGTTATTACTTCTCTCACTTCCTGTACTAGCAGCCGGAATTACAATACTGTTAACAGACCGAAATTTAAATACAACTTTCTTTGACCCAGCAGGAGGCGGAGACCCTATTCTGTACCAACACCTGTTCTGATTCTTTGGCCACCCTGAAGTATATATTCTTATTTTACCCGGCTTCGGTATAATTTCTCACATCGTAACATACTACTCAGGAAAAAAAGAACCGTTTGGATATATGGGAATGGTTTGGGCTATAATATCAATTGGATTCTTAGGATTTATCGTATGAGCCCACCACATGTTCACAGTTGGAATAGACGTTGACACACGAGCCTATTTCACATCAGCTACCATGATTATTGCCATCCCAACTGGAGTAAAGGTCTTTAGCTGATTGGCTACACTTCATGGAGGTAATATCAAATGATCACCTGCTATAATATGAGCCCTAGGCTTTATTTTCCTCTTTACAGTTGGAGGCCTAACAGGAATCGTTCTTGCTAATTCTTCTCTTGACATTGTTCTCCACGACACATATTACGTAGTTGCACACTTTCACTACGTACTATCAATAGGAGCCGTATTCGCTATTATAGGGGGGTTTGTTCACTGATTTCCGCTATTCTCAGGATATACCCTAAACAACACATGAGCTAAAATTCATTTCGTAATCATATTTGTGGGTGTAAATATAACTTTTTTTCCACAACATTTCCTAGGACTGTCCGGCATGCCACGACGTTACTCTGACTACCCAGATGCATATACAATATGAAATACCATCTCATCCATAGGCTCATTTATTTCTCTAACAGCAGTTATACTAATAATTTTCATTATCTGAGAAGCATTTGCATCTAAACGAGAAGTCCTGACCGTAGAACTGACAACAACAAACCTAGAGTGACTAAACGGATGTCCTCCGCCATACCACACATTTGAAGAGCCTACATACGTTAATTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Muntiacus vuquangensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd+3cd+4cd

Version
3.1

Year Assessed
2008

Assessor/s
Timmins, R.J., Duckworth, J.W. & Long, B.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
Hunting pressure is extremely high throughout most of the Large-antlered Muntjac’s small global range, resulting in population densities of almost all mammals of comparable (or larger) size greatly below pre-exploitation levels and, within the region, declines probably exceed 30% over the last 15–25 years even for the most resilient species such as Northern Red Muntjac (see that species' 2008 Red List account). Based, particularly on camera-trapping results, Large-antlered Muntjac in most of its presumed range has a local population status more similar to the likes of Tiger, Saola and Gaur, all species unquestionably critically endangered (declines of 90% or more in the last 20–30 years) within the range of Large-antlered Muntjac, than to species such as Northern Red Muntjac, even though the latter is congeneric. Although the paucity of solid survey data hinder the use of range reduction in red listing this species, it is likely to be a contributory factor particularly in the next three generations when ongoing hunting and habitat trends will exterminate many of the small and isolated populations presumed still to persist. The extreme paucity of recent records from most of this muntjac’s known range, coupled with the ease with which it is found in the Nakai plateau and some parts of the Nakai–Nam Theun NPA, indicate that the species is now at very low densities, with a presumably numerically small but incalculable population. Within most of its range, the species may never have been as common as Northern Red Muntjac overall, even though locally they are sometimes similar in abundance. But such a difference cannot be assumed; it may simply be that by the time of its scientific discovery, Large-antlered Muntjac was already greatly reduced across most its range, in the same way that sympatric Tiger, wild cattle, Asian Elephant and even Sambar were by the early 1990s in Lao PDR and Viet Nam. However, assuming that pre-exploitation densities were in general somewhat lower than those of Northern Red Muntjac, the very low densities now indicate at least a 50% reduction in about 21 years (7 year generation time) in all of past, present and future. Data do not exist to allow empirical determination of actual decline rate, but its magnitude has been based on: such a level of reduction in population would be barely detectable by survey styles to date; the species rarity seems both unnatural and recent, reflecting the massive scale of trade-driven snaring and the ubiquity of ‘subsistence’-level snaring; the ubiquity of non-targeted hunting methods which will wipe out even relict populations of individual species provided some species remain in numbers sufficient for hunting to be viable; the apparent association of the species with lower and mid altitude forests, probably particularly with broken canopy, and thus the overlap of populations with the highest hunting levels for wild meat, and the lack of secure source populations in large rugged forest-clothed massifs; the presence of a large hydropower project within the healthiest known population, which will flood some prime habitat and is, unintentionally, greatly facilitating trade-driven hunting throughout that population; and the inability of the last 15 years of stepped-up conservation activities in the region to make any serious inroads on hunting and trading of ungulates. It is vital that the surveys proposed in southern Viet Nam are undertaken and that the Nakai Plateau and Nakai–Nam Theun population be monitored closely in coming years; and that, based on these sources of information, the red list categorisation be reviewed regularly.

History
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In 1994, giant muntjacs were protected under Appendix I in CITES. Although they have not yet been accessed by IUCN, it is believed that the species belongs on the Red List. Laos and Vietnam have taken steps to help protect the area's biodiversity by creating several National Biodiversity Conservation Areas in and near the Annamite Mountains. In addition, the Nakai-Nam Theun Natioanl Biodiversity Conservation Area in Laos may be a core area for giant muntjac populations. This area is contiguous with the Vu Quang Nature Reserve in Vietnam.

The conservation of giant muntjacs has been impeded by a newly formed government conservation strategy and a shortage of funding and trained workers. They are also threatened by hunting in conservation areas by locals and the popularity of slash and burn farming.

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Evidence for the Large-antlered Muntjac comes from much of the Annamite mountain range, mostly as trophy antlers in villages abutting or within forest (Timmins et al. 1998; Do Tuoc and Le Trong Trai pers. comm. to R.J. Timmins 1990s; B. Long pers. comm. to R.J. Timmins 2006; W.G. Robichaud pers. comm. to R.J. Timmins 2007; R.J. Timmins pers. comm. 2008). The very little field-based evidence of Large-antlered Muntjac contrasts with Northern Red Muntjac Muntiacus vaginalis being among the most frequently recorded large mammals during field surveys in Lao and Viet Nam (Timmins et al. 1998; Timmins and Ou 2001; R.J. Timmins pers. comm. 2008).

In most known Lao sites holding Large-antlered Muntjac, few trophies were found compared with those of Northern Red Muntjac; the only exception is the Nakai Plateau and Nakai–Nam Theun NPA where, overall, numbers of trophies of the two species were roughly equal, and which constitute the only area of Lao PDR in which trophy evidence was found commonly over a wide area (Schaller and Vrba 1996; Timmins et al. 1998). Around the Nam Noy and Nam Phao, Large-antlered Muntjac trophies even outnumber those of Northern Red Muntjac (W.G. Robichaud pers. comm. 2008, based on survey in 2007–2008). Distribution in the Xe Sap NPA–Dakchung Plateau area, another region of the main Annamite spine visited several times appears, by contrast, to be patchy (Schaller and Vrba 1996; Showler et al. 1998; Steinmetz 1998; Steinmetz et al. 1999; Timmins et al. 1998). During 1998–1999, camera-trapping in Bolikhamxai Province recorded the species only twice (Robichaud and Stuart 1999). Otherwise there has been substantial camera-trapping effort within the species’s suspected Lao range only in the Nakai Plateau and Nakai–Nam Theun NPA. Camera-trapping in 2007–2008 recorded many Large-antlered Muntjacs in some sectors in a ‘trap’ encounter rate similar to that of Northern Red Muntjac there (Robichaud et al. in prep.). However, occupation of the NPA seems to be patchy: in one of its three sectors where camera-trapping was carried out, no Large-antlered Muntjacs were found, although Northern Red Muntjac and the M. rooseveltorum species-complex were recorded frequently (Robichaud et al. in prep.). The plateau and NPA’s Large-antlered Muntjac population stood out as exceptionally large both a decade ago (when it could be compared with many other sites surveyed using comparable methodology) and in a present-day context (despite a lack of similar studies in other sites). In an Indochinese context, the Nakai Plateau and Nakai-Nam Theun NPA were found in 1994–1996 to hold substantial populations of other wildlife which have declined steeply through over-harvest in Indochina. Recent (2006–2007) surveys of the plateau showed that some are now gone, such as Tiger Panthera tigris, but others, such as turtles, otters, Asian Elephants Elephas maximus, and, of most direct relevance to inferring the status of this muntjac, Sambar Rusa unicolor remain in numbers outstandingly high compared with other areas surveyed about the same time (Dersu 2007; R.J. Timmins pers. comm. 2008). This situation defies ready explanation given the geographic location (the plateau is particularly accessible) and the presence of a major hydropower project which has boosted the local economy (and therefore fuelled extraction of tradable wildlife) for five years and stimulated heavy logging for over a decade (Evans et al. 2000; WCS 1995; Timmins and Ou 2001; Dersu 2007).

In general, surveys undertaken throughout Lao PDR suggest that typical quarry species of large mammal are well below carrying capacity even within large habitat blocks (Timmins and Ou 2001; Timmins and Duckworth in press), and the paucity of evidence for the Large-antlered Muntjac elsewhere in its Lao range indicates a conservation status similar to that of wild oxen or large hornbills, rather than to that of other ungulates of comparable size such as other muntjac species or pigs. Camera-trapping in the Nakai-Nam Theun NPA during 2006–2008 indicates substantial declines of ground-dwelling large mammal populations especially Sambar, cats and Large Indian Civet Viverra zibetha, by comparison with direct observation and sign surveys in 1994–1996; intensive snaring is now commonplace within the NPA and the area has particularly suffered from incursion from over the Viet Namese border (Duckworth 1998; Evans et al. 2000; RJT pers. comm. 2008 based on WMPA unpublished data; W.G. Robichaud pers. comm. 2007). Although muntjacs of all species are still apparently numerous in this NPA, significant declines are likely to be in progress, as on the Nakai plateau (the semi-quantitative methods used have low power to detect changes even of quite large proportion, if the species is still ‘common’). Elsewhere in Lao PDR over the same period, anecdotal information and a small number of re-surveys suggest that declines in mammals of muntjac size and over (in magnitude obvious even by subjective survey means) are widespread (Timmins and Robichaud 2005; J.W. Duckworth pers. comm. 2008, but based largely on areas outside the Large-antlered Muntjac’s range).

In Viet Nam the situation seems to be similar, with no evidence for anything other than very small numbers surviving, although one area which seems to have held large numbers at least into the 1990s has not been re-surveyed. In and around Pu Mat Nature Reserve, despite a number of trophies in local villages in the 1990s, fairly intensive camera-trapping in the late 1990s resulted in perhaps only one image of Large-antlered Muntjac compared with dozens portraying Northern Red Muntjac and several showing animals of the M. rooseveltorum group (Timmins et al. 1998; SFNC 2000; RJT pers. obs. based on SFNC unpublished data). However, the spatial overlap between the areas providing the village trophies and where camera-trapping took place is not known. Slightly further south in Vu Quang Nature Reserve, Dawson and Do Tuoc (1997) considered Large-antlered Muntjac as common as Northern Red Muntjac, an assessment echoing that from the adjacent Lao area of Nakai–Nam Theun NPA and Nakai plateau (see above). However, Eve et al. (2001: 45 and 122) concluded a major decline at Vu Quang NR during the 1990s: Dawson (1994) recorded that 13 Large-antlered Muntjacs were caught in snares in the 1993/1994 season alone, and observed one of the species in the southern part of the reserve at this time, but in several years’ presence, including various biological surveys, in the late 1990s, no new evidence of the species was recorded. However, it is unclear to what extent hunted animals were being monitored, and the initiation and consolidation of an international conservation project at this site should have made it more difficult to learn about what animals were being hunted, thereby presumably exaggerating the apparent decline.

From Vu Quang NR southwards, there are, as in Lao PDR, sporadic records of trophies, but little information other than, in many instances, anecdotal reports of the species’s scarcity (see Distribution). Extensive camera-trapping in Thua Tien Hue and Quang Nam Provinces captured only a single possible Large-antlered Muntjac against numerous pictures of Northern Red Muntjac and several animals of the M. rooseveltorum species-complex. This evident current rarity seems to reflect a steep recent decline rather than naturally low densities based on interviews of villagers throughout Quang Nam, Hue and Quang Tri provinces (B. Long pers. comm. 2008).

In the mid 1990s, two Hanoi institutes obtained five freshly hunted animals from the Lam Ha District, Lam Dong Province in the Southern Annamites (see Distribution) where the species was said to be relatively common (Do Tuoc and Pham Trong Anh pers. comm. to R.J. Timmins). The Da Lat biology institute in Lam Dong Province began amassing specimens in 1990 and by October 1995 held only 271 mammal specimens. Remarkably, 19 (in translation: six stuffed mounts; four skinned heads (skulls?) and 9 skins (trophies?)) of these were of M. vuquangensis, against only 12 M. vaginalis. These were the two most numerous mammal species in the collection (Pham Trong Anh et al. 1996). It is not known if the institute deliberately sought Large-antlered Muntjac, or whether the numbers reflect the relative frequency with which animals were being hunted. There has been no published field survey of this area, so present conservation status of Large-antlered Muntjac there is unknown. Southern Viet Nam in recent decades often has proved to harbour less depleted large mammal populations than further north (e.g. Le Xuan Canh et al. 1997, Polet and Ling 2004), but hunting still is ubiquitous and is probably increasing (see Threats). In Viet Nam, especially the north, large mammal densities are even more depressed than in Lao PDR (Timmins et al. 1999; Timmins and Trinh Viet Cuong 2001; Timmins 2002; Timmins and Ou 2001; Timmins et al. 2007; R.J. Timmins pers. comm. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
As of 2008, suitable habitat for the Large-antlered Muntjac is still extensive (under the reasonable assumption that it uses secondary forest), but, especially within Viet Nam, it seems absent from many accessible, but superficially, at least, suitable habitat blocks. This strongly indicates that overhunting is its primary threat. Heavy deployment of camera-traps in several interior forests of Viet Nam produced few photographs, showing that Large-antlered Muntjac can be rare even in the most remote areas. A decline in them would suggest great susceptibility to hunting, but it is possible that it was never common in the types of interior closed-canopy forest surveyed and is restricted to specific types (not yet camera-trapped) or may even be strongly associated with edges. If the latter, then a high proportion of the population would be facing very heavy hunting pressure, because of proximity to settlement of much of the suitable habitat. Whatever the explanation for the rarity of records in most camera-trapping areas, it suggests a much stronger level of threat than has hitherto been appreciated (e.g. by Timmins et al. 1998, Duckworth et al. 1999; the listing as only Provisionally At Risk in Lao PDR in the latter is now clearly inappropriately optimistic). While the socio-economic factors outlined in this section bear on the conservation status of all ungulates and primates, of most carnivores, and of many other mammals in Lao PDR and Viet Nam, Large-antlered Muntjac is probably one of two species (the other being Saola Pseudoryx nghetinhensis) which is most at global risk through them. This is because it is big enough to be a main wildlife meat source; it does not have populations secured in other countries such as India, Nepal and Thailand, with installed effective management in at least some protected areas; it does not have populations in the rugged mountain forest blocks where trade-driven hunting of species valued only for their meat (rather than high-value, low-weight, generally medicinal products that can be carried out efficiently from even the remotest areas) is limited by economics of accessibility; and it does not occur on the plains where (for a mix of essentially non-biological reasons) protected area management is being most successful in conserving ungulates (e.g. Cambodia, and Cat Tien National Park, Viet Nam).

Large-antlered Muntjacs are hunted within a thriving hunting and wildlife trading culture in all range states and in adjacent countries such as China and Thailand, involving many land vertebrate species, along with other forest products such as orchids and Aquilaria resin (e.g. Compton and Le Hai Quang 1998; Compton et al. 1999; Noreen and Claridge 2001). Hunters do not target Large-antlered Muntjacs, but are seeking any and all species with marketable meat and products for the medicinal markets. Such hunting reaches all this muntjac’s range, and with so many species and products, non-selective methods continue at high levels until the most resilient species is no longer common enough for hunting to be commercially viable. This non-specificity makes regional hunting practices a peculiarly strong driver of localised and, in aggregate, regional, extinctions (e.g. Tungittiplakorn and Dearden 2002). The regional wild meat trade has little likelihood of abating as long as there are any pigs, muntjacs, and civets to be hunted; Large-antlered Muntjacs will be extinct long before these more resilient species become so rare that communities are driven to ‘fishing down’ for smaller species using methods that do not threaten Large-antlered Muntjacs. The human population of Viet Nam is more than 84 million, that of China more than 1,000 million. Together, they comprise an enormous market for wildlife products. For example, tens of millions of wild turtles are imported, legally and illegally, into China annually (van Dijk et al. 2000 and papers therein). There has been no comparable study of ungulate trade levels.

Hunting in Large-antlered Muntjacs's range is therefore very high: in the Northern and Central Annamites of Viet Nam, in a range shared with Saola, an estimated eight million people, almost all with the propensity to eat wildlife and mostly with direct links to the urban wildlife trade, live within 100 km of forest inhabited by Saola, and probably nowhere in the range of Large-antlered Muntjac is further than 30 km from a village (Timmins et al. 2007; R.J. Timmins pers. comm. 2008). Within the Northern and Central Annamites, every square kilometre of Viet Namese forest and of Lao forest that is within 5 km of the Viet Namese border probably has snares capable of capturing Large-antlered Muntjac set in it every year (Timmins et al. 2007; R.J. Timmins pers. comm. 2008). Intensity in some areas probably reaches many thousands of snare-nights per km² per year (Timmins et al. 2007). Snaring is less intensive in Lao PDR at least away from the Viet Namese border, but is increasing dramatically. Hunting intensity has in recent decades been generally lower in southern Viet Nam than in Lao PDR and northern Viet Nam, leaving many wildlife populations less depleted (e.g. Le Xuan Canh et al. 1997; Timmins and Duckworth 2000; Polet and Ling 2004), but the general increase in regional hunting intensity and economic wealth indicate that hunting intensity in this region must also be increasing.

Closed tropical evergreen forests have inherently low ungulate biomass (Robinson and Bennett 2000), and beyond this populations of all wild animals larger than 20 kg in most of Large-antlered Muntjac’s range have been significantly reduced by human exploitation (Timmins and Ou 2001; Timmins et al. 2007; R.J. Timmins pers. comm. 2008); the paucity of records across its range shows that this includes Large-antlered Muntjac itself. Field survey encounter rates even with Northern Red Muntjacs and pigs in much of Large-antlered Muntjac's range are remarkably low compared with other areas in Asia (Timmins and Ou 2001; Timmins et al. 2007; R.J. Timmins pers. comm. 2008), wild cattle, elephants, and Tigers are all nearing extinction in this muntjac’s range (e.g. Duckworth and Hedges 1998), and in some of the worst-hit protected areas even the generally robust Northern Red Muntjac and wild pig are ecologically extinct (e.g. the western lowlands of Xe Bang-Nouan NPA, Lao PDR; J.W. Duckworth pers. comm. 2008, based on 2007 field visit). In the Nakai Plateau and Nakai-Nam Theun NPA, in some sectors the Large-antlered Muntjac and Northern Red Muntjac are similar in abundance. Comparison with other areas, where the former is much scarcer than the latter, implies that the Large-antlered is much more sensitive to hunting than is the Northern Red. It may be intentionally targeted more (although there is no evidence for this, and it seems unlikely), or some facet of population biology such as fecundity (possible given its slightly larger size) may make it less resilient, or it may be associated with habitats that (for other reasons) are targeted by hunters. This latter factor is certainly true at the landscape scale: Large-antlered Muntjac primarily uses lower altitudes, yet forest blocks remote enough for hunting levels to be restrained by the economics of access and removal of meat are primarily mountainous areas of high altitude forest. If Large-antlered Muntjac is an edge species, densities in large unencroached closed forest blocks would be low anyway. The lower-altitude disturbed forests may be the most suitable habitat for this muntjac, but because they are closer to high human population densities than are montane or little-encroached blocks, they support higher levels of generalised snaring and hunting. In comparison, Northern Red Muntjac has large populations in such high altitude remote forest blocks, which may act as a repopulation reservoir for lower altitude areas. It is difficult to think of any habitat that could be a source for Large-antlered Muntjac.

While wild meat is the major driver of muntjac trade, parts such as antlers may be used in for medicinal purposes. There is also the curio/status symbol appeal of trophy antlers: some are even on display in Bangkok (A.J. Lynam pers. comm. 2000).

The effects of hunting in Lao PDR and Viet Nam have been exacerbated during the last two decades by habitat loss and various socio-economic factors, of which the most biologically significant seem to be:

Economic development and expanding wealth in the region are increasing the demand for wildlife meat and ‘medicines’ (Timmins et al. 2007). Timmins et al. (2007) highlighted a common misconception, especially in documentation of development projects in the region, that poverty is a principal cause of biodiversity loss, but as they pointed out for Saola, the main driver of threats for Saola, Large-antlered Muntjac and many other species, at least for the mid-term, is not rural poverty but increasing urban wealth in Indochina and China. In Viet Nam “the free market economy has resulted in feverish periods of trade in wild species nationwide, with negative impacts on biodiversity” (Government of the Socialist Republic of Viet Nam 2004). In Cambodia, the same factor has fostered a thriving bushmeat market and hunting of species for international wildlife trade (Timmins and Ou 2001; Maxwell et al. 2006; Timmins 2006). There is a rapid, ongoing, expansion of wealthy social strata in Lao PDR, directly accelerated by illegal trade in rosewood, wild meat, and other forest resources, and by the economics of large infrastructure projects (e.g. Nan Theun 2 hydro-electric power project), creating a significantly greater in-country demand for luxury meats such as venison (W.G. Robichaud pers. comm. 2007). Markets along major roads such as route 13 (e.g. at Ban Namthon) have expanded, not contracted, in the last 15 years and have a huge (albeit unquantified) turnover of wild meat; at this specific market, multiple stalls are selling dried muntjac meat daily (balance of muntjac species unknown).

Road development in Viet Nam, especially the recent construction through the Annamite Mountains in Viet Nam of the Ho Chi Minh Highway, parallel to the Lao border, with its many feeder roads to Lao PDR and Cambodia that boost connectivity of rural areas to regional wildlife trade markets, is a severe and probably unmitigatable threat (Timmins et al. 2007; R.J. Timmins pers. comm. 2008). In the last decade there has also been a dramatic upgrading and expansion of national and regional road networks in Lao PDR, primarily it seems to make all inhabited areas of the country readily accessible (W.G. Robichaud pers. comm. 2008). New road linkages in Mondulkiri Province, Cambodia, are making the area’s natural resources more easily marketable (R.J. Timmins pers. comm. 2008).

Shifting cultivation of local communities is resulting in a net loss of forest and even of dense secondary habitats, and is fragmenting larger forest blocks because of the dispersion of settlements. Shifting cultivation per se could even be beneficial for this muntjac, but recent trends are decreasing the suitability of what might be called ‘the shifting cultivation estate’. These trends centre round a decline in cycle length in rotational systems (hindering regrowth during the fallow period), partly through the increasing number of people depending upon an annually decreasing area, as forest land is lost to infrastructure, tree plantation crops and other forms of continuous agriculture, and partly through well-intentioned government policy to eradicate shifting cultivation.

Recent moves towards landscape-scale habitat clearance for agro-industrial developments particularly in plateau areas of Cambodia and southern Viet Nam, and even in foothill areas of northern parts of the Lao and Viet Namese range of the species, would presumably remove available habitat, further fragment remaining forest areas, increase local affluence and result in new roads. However, this muntjac’s potential use of plantations is not assessed, and probably cannot be, because all such developments are increasing the area in which hunting is easy and at high levels (R.J. Timmins pers. comm. 2008).

Hydropower development throughout the Annamites, particularly in the Nam Theun/Nam Kading basin in Lao PDR, flood habitat but more importantly fuel hunting levels through increasing affluence and market connectivity. The Nakai Plateau, part of the only area known still to support good numbers of Large-antlered Muntjac, is being flooded for a hydropower headpond during mid 2008. This will destroy only a part of the species' range on the plateau, but the project will continue to stimulate hunting. Currently, there are barely-navigable stretches of rocky channel (called kengs) on all streams flowing out from the NPA. All these kengs will be easily passable when the reservoir is full. Nam Kading NPA, further down the same catchment, is also threatened by a hydropower project which will result in a highly dendritic headpond allowing ready access to most of this NPA and so undoubtedly will increase hunting levels significantly.

Growing economic stability and developing infrastructure in all three range countries have initiated a flood of proposals for industrial scale mineral extraction, particularly in the mineral-rich Annamites (R.J. Timmins pers. comm. 2008). The effects of this on proportionate loss of habitat remain to be seen; they will probably be overshadowed the presence of large numbers of non-local workers with good market connectivity and thus a propensity to hunt, or to pay local people to hunt.

Recent changes in immigration agreements between Lao PDR and Viet Nam and between Lao PDR and China make it much easier for Viet Namese and Chinese people to visit, settle in and conduct business in Lao PDR, and with a clear build up of Viet Namese nationals in pivotal wildlife trade centres such as Ban Lak-20 (= ‘Ban Lak Xao’) on the edge of Nakai–Nam Theun NPA, trade networks with Viet Nam are now better than ever and still improving (W.G. Robichaud pers. comm. 2007).

Additional factors hindering the species' survival include:

The difficulties of distinction between this species and Northern Red Muntjac impede its potential legal protection, particularly in situations where a differential status between the Large-antlered and Northern Red applies.

Customary rights of local people to hunt ‘sustainably’ within most Lao and Viet Namese protected areas urgently need modification if most of the ungulate species are to survive in such areas (see Conservation Measures).

As pointed out by Timmins et al. (2007), protected area management skills and commitment to the system are still evolving in the Annamites, and this progress lags behind expansion of market-led hunting. Currently, existing protected areas are not stanching declines in ungulates. Protected areas have so far proven impotent in the control of poaching or as a mechanism to safeguard areas from economic development such as hydropower projects, road construction, and mining (Timmins et al. 2007). It will require a major consolidation of effort to install effective anti-hunting measures in any protected area within the range of Large-antlered Muntjac within the next five years (Timmins et al. 2007; R.J. Timmins pers. comm. 2008) and protected area strengthening projects should be thinking in terms of a few decades of collaboration, not a few years (e.g. Leisher 2001). Yet, there is even the danger of the few currently promising protected areas regressing through loss of external funding and talented professionals, ongoing political indifference towards them, and thereby forcing an unfettered short-termism in local residents’ behaviour through a lack of alternative options. There is no plausible method to conserve this species (and others of high value to the wildlife trade which show little resilience to hunting) alternative to protected areas; the problem is arising not through a flawed concept, but through naive optimism about the time-scales and resource inputs needed to effect situational change.

There is a lack of appreciation in the decision-making levels relevant to protected areas, including those with externally collaborative management support projects, of the biodiversity value of lower altitude yet degraded forests relative to high altitude forests which have been less encroached. This results in mis-prioritisation of zones within the protected area. The common situation is that all lower-altitude forests are degraded, and it is this very degradation that makes them of high priority: their conservation status is already so poor that there are no pristine areas left in most of the range of the Large-antlered Muntjac. This is a problem for a wide suite of species restricted to the lower altitudes, not just to this muntjac, but because of its globally small range, it may be the mammal at most global risk through this factor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed in CITES – Appendix I.

The survival of the Large-antlered Muntjac depends on the viability of populations within protected areas, many of which (particularly in Lao PDR) are currently potentially highly suitable for their species due to their typically large size (Timmins et al. 1998; see also Timmins and Duckworth 1999; Timmins and Duckworth in press). Although Large-antlered Muntjac populations within protected areas face unrestrained hunting, populations outside protected areas are likely to be faring even less well. The limited success to date for protected areas is a reflection of the time it takes to form an effectively functioning system (see threats), rather than a demonstration that the species would better be conserved outside them. Actions of primary importance include the stemming of further habitat loss at lower altitudes, and most importantly controls on hunting (Timmins et al. 1998).

The single most important conservation measure for the Large-antlered Muntjac is to maintain conservation support for management of the Nakai–Nam Theun NPA, and to help strengthen protection activities there, especially through building technical capacity. Other important protected areas in which to develop management are potentially Nam Kading NPA, as it is already the site of an externally funded protected area management project. A protected area management project is in its infancy in Nakai-Nam Theun NPA, and although well funded for the long-term, the project faces significant challenges, primarily due to low technical capacity and government policy which favours tangible aspects of rural development (road building, plantation agriculture, etc.) over what is perceived as ‘wildlife conservation’ but which should better be seen as securing the protein base and ecologically functioning forests in the interests of the nation and, notably, of subsistence-level rural communities (see below). Few other protected areas within the Lao or Viet Namese range of the species currently have more than paper management. Conservation management needs much wider recognition of the value of lower-altitude forests in protected areas throughout the species’s range, even though (and in fact because) these are generally degraded and from a forestry perspective seem of low importance (see Threats).

Conservation area management in all protected areas within the species’s range must address the issues of how customary hunting by local people can be continued without serious long-term declines in wildlife. The latter is a precondition for the former: customary hunting will have to stop when wildlife stocks become ecologically extinct. The magnitude of difficulty of this balancing act is often underestimated, through an uncritical acceptance of the fact (in any case, disputable, when status of rhinoceroses in South-east Asia and a multitude of species in south-central China is considered) that before ‘international’ conservation principles and practice these species did not become extinct under the custodianship of customary hunting. This is a flawed comparison because in the intervening period human populations have exploded; much wildlife habitat has been lost to other land uses; modern weapons allow far more effective harvest of wildlife than did any customary techniques; and modern connectivity and urban affluence have generated a limitless market for wild meat. In sum, many more people depend on a far smaller area than before, and a new, infinite market can be met using hunting methods which previously did not exist. This means that there is no possibility that unfettered ‘customary’ hunting can conserve ungulates in Lao PDR and Viet Nam, even if ‘customary hunting’ could be defined in a modern context. Greater recognition is also urgent that the two groups that will chiefly bear the damage of current heavy hunting are, self-evidently, the wildlife and, perhaps paradoxically, the local communities: after the current short-term bonanza is over, local people who have not bought their way out of subsistence (and current trends suggest this will be a large proportion of them: most of the financial benefits of wildlife trade flow to already-urbanised traders and other adventives) will lose this income source and most of their non-fish protein. Instead of the currently sterile polarisation within conservation implementing agencies of ‘local people vs wildlife’, which would better be termed ‘short-term human interest vs long-term human interest’, universal recognition that wild mammals are fundamental to rural poverty alleviation is needed (Krahn and Johnson 2007). Inviolate non-hunting core areas may be the most important tool in meeting this challenge. Even though they can legally be established in protected areas in both countries, there has been minimal progress in this regard. Designation and outlining of core areas needs to flow from biologically sound analyses of population needs of species such as the Large-antlered Muntjac, to prevent core areas too small to sustain off-take in surrounding hunting zones or even survival within the core zones themselves. It is important that core areas are not selected starting from the assumption that they will be the areas traditionally not part of local community hunting areas: in many protected areas, these will be remote high-altitude terrain, and thus largely unsuitable for Large-antlered Muntjac. There is the danger that this occurs through the well-meaning intention, to minimise disruption to already marginalized communities. Instead, a longer-term viewpoint is necessary, that if core areas do not succeed in protecting populations of favoured quarry mammals, serious dietary and resource-flow disruption to these same communities is inevitable. It is already happening in some parts of Lao PDR (Krahn and Johnson 2007) and, presumably, Viet Nam.

Surveys for the Large-antlered Muntjac (a combination of searches for evidence in local villages followed by camera-trapping) in Viet Namese portions of the Southern Annamites, especially Lam Dong Province, are needed, and on the basis of results, site-based conservation interventions may be warranted. The same may be true for yet-to-be identified areas of the southern Central Annamites. The weak understanding of Large-antlered Muntjac’s habitat use means that any indirect means (e.g. through habitat cover) to propose key sites for conservation intervention may simply overlook not just the best, but even any plausibly sensible, areas to select.

The Cambodian population, if extant, may be covered partly by the one or more protected areas (Phnom Nam Lyr WS; Mondulkiri Protection Forest; Siema Biodiversity Conservation Area), other parts of it might, however, occur outside these areas. There are, however, no serious protection activities within its presumed national range. Camera-trapping surveys are warranted, and on the basis of results localised species-specific conservation interventions might be appropriate.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No negative impacts could be found.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The meat of giant muntjacs is a food source for local villagers and there is a market for wider distribution of meat in cities and towns.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Giant muntjac

The Giant Muntjac sometimes referred to as the Large-Antlered Muntjac (Muntiacus vuquangensis) is a species of muntjac deer. It is the largest muntjac species and was discovered in 1994 in Vũ Quang, Hà Tĩnh Province of Vietnam and in central Laos. During inundation of the Nakai Reservoir in Khammouane Province of Laos for the Nam Theun 2 Multi-Purpose Project, 38 giant muntjac were captured, studied and released into the adjacent Nakai-Nam Theun National Protected Area. Subsequent radio-tracking of a sample of these animals showed the relocation was successful.[2] The species is also located in parts of eastern Cambodia, as well as the Trường Sơn Mountains.[3] The giant muntjac is commonly found in evergreen forests and weighs about 66–110 lb (30–50 kg).[4] It has a red brown coat and is an even-toed ungulate. Due to slash-and-burn agriculture, combined with hunting, the giant muntjac is considered endangered. It is preyed upon by animals such as the tiger and leopard. It is most closely related to the Indian muntjac.

References[edit]

  1. ^ Timmins, R. J., Duckworth, J. W. & Long, B. (2008). Muntiacus vuquangensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 5 April 2009. Database entry includes a brief justification of why this species is of endangered.
  2. ^ Stone, R. (2009). "Dam project reveals secret sanctuary of vanishing deer". Science 325 (5945): 1192–1192. doi:10.1126/science.325_1192b.  edit
  3. ^ WWF: Giant muntjac (Muntiacus vuquangensis)
  4. ^ Animal Info - Giant Muntjac
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!