Overview

Brief Summary

Taxonomy

Morphology
Melolontha melolontha
  • is about an inch in length
  • has short feelers on its black head and
  • has a hairy body
  • has non-hairy reddish-brown wing cases (when seen with the naked eye)


Lookalike
Melolontha melolontha has a similar-looking but smaller relative that appears later in the year called the summer chafer (Amphimallon solstitialis). This is on average about half an inch in length and also has a hairy body under reddish-brown wing cases but has long sparsely arranged hairs (when seen with a hand lens or magnifying glass).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Melolontha melolontha the May bug or cockchafer is not a true bug but a relatively large beetle found more commonly in the south of the UK.Melolontha melolontha normally appears flying on warm evenings from May to July. Melolontha melolontha is attracted to artificial light and often comes indoors through open windows or even down chimneys. May bugs may cause consternation to those who encounter them but are harmless to humans.Melolontha melolontha grubs, however, are considered a pest feeding underground on the roots of a wide range of plants and can damage pastures and crops.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Adult cockchafers eat leaves and flowers of a range of deciduous trees, plants and shrubs but do not tend to be serious pests in Britain. The larvae, on the other hand, can be serious pests of grasses and cereals, as they live in the soil feeding on roots. They can be serious pests in gardens, nurseries and pastures, causing brown patches of grass to appear. They also attack other garden plants and vegetables (4).  Adults appear in April or May. They feed for a time, and females become mature at 10 to 15 days after emergence. After mating, females lay around 20 eggs in soft soil. A large number of females die after egg-laying, but some return to feeding and may then go on to lay a second or even third batch of eggs (5). After 4-6 weeks the larvae hatches out. It takes 3-4 years for the larvae to become fully developed, and they burrow deeper into the soil each winter to hibernate (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This common, large beetle often crashes into lighted windows at night during early summer (3). It is a familiar beetle that belongs to the same family as dung beetles (Scarabaeidae) (4). As it flies it produces an alarming loud buzzing noise, but it is harmless to humans (3). The ribbed wing cases or 'elytra' are reddish-brown in colour, and the head and the pronotum are blackish and covered in short hairs. The fan-like antennae are longer in males than females (5). The larvae are fat white grubs that typically have a curved body shape and live in the soil. They can grown up to 40 to 46 mm in length (5). 'Chafer' is a Middle English word which is thought to mean 'to gnaw'. The prefix 'cock' is often used to signal maleness, but it may be a simple term of familiarity (6). The larvae are often called rook-worms, as rooks are said to have a particular love of both adult and larval cockchafers (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Lifecycle
The complete life-cycle cycle from egg to adult is usually 3-4 years.

Grubs
The grubs (commonly called white grubs) are `C' shaped, have six legs and are white with reddish-brown heads.They hatch from the eggs in about 5-6 weeks and can grow to one and a half inches in length when fully mature.They can be eaten by rooks, crows and gulls if exposed by ploughing.The grubs live for 3 years and usually turn into pupae at the end of their third summer. They then change into adults and stay underground during the winter and emerge in the following year.

Adults
The adults emerge from the soil and fly towards trees to gather together and mate. Fertilised females fly back to the open treeless areas from where they emerged and burrow underground in order to lay their eggs on roots.Adults are active fliers at dusk onwards. They feed on leaves after dark and rest on trees during the day.They only live for about a month in all and can be eaten by owls and bats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Also known as the June bug or May bug, the common cockchafer is found throughout temperate Europe and the continental United States.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution habitat

Distribution
This species is found in:
  • Europe
  • Northern Asia
  • Mediterranean Basin
  • UK, where it is more common in the south than in the north


Habitat
Adult May Bugs are associated with deciduous woodland. The grubs occur in nearby gardens, pastures, parks and nurseries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Widespread and common throughout much of Britain, but less common in the north (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult cockchafers typically range from 25 to 30mm. Adult Melolontha melolontha have a dark head with a shiny black pronotum covered by short, closely set hairs. They also have a dull black abdomen and a long, flat pygidium. Eyes are multifaceted, with 5,475 facets per eye, providing very acute vision. Males have longer antennae than females, with a large, fan-like club protruding from each terminus. New wing cases are typically mottled with a white powder. Immature (larval) common cockchafers reach lengths of about 40 to 46mm, and have a dull white body colored black at the abdomenal extremity. Cockchafer grubs curve into an arc and have a large head with strong, grabbing mandibles. In overall appearance grubs are fleshy, elongated, and slightly hairy.

Range length: 25 to 30 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

  • Burton, J. 1979. The Oxford Book of Insects. New York: Oxford University Press.
  • Pesson, P. 1959. The World of Insects. New York: McGraw-Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Common cockchafers typically live in areas with soft, shaded soil. The cockchafer is frequently found on agricultural land.

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in a range of habitats including gardens and agricultural land (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

In April and May, adult cockchafers fly singly in search of food. Melolontha melolontha ear deciduous tree and fruit tree leaves, particularly oaks, maple, sweet chestnut, beech, plum, and walnut trees. While adults are considered harmful only in large populations, the eating habits of larvae cause far more damage to crops. Larvae gnaw at small roots of field plants, and are indiscriminate feeders; they eat grain, grass, tree, and beet roots, moving as much as 30 cm a day while eating large sections of crop rootlets. Cockchafer larvae feed on new, fresh soil roots and do not usually eat decaying organic matter.

Plant Foods: leaves; roots and tubers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasitoid / endoparasitoid
larva of Dexia rustica is endoparasitoid of larva of Melolontha melolontha

Animal / parasitoid / endoparasitoid
larva of Dexiosoma caninum is endoparasitoid of larva of Melolontha melolontha
Remarks: Other: uncertain

Plant / resting place / on
swarming adult of Melolontha melolontha may be found on canopy of Malus
Remarks: season: 5-6

Plant / resting place / on
swarming adult of Melolontha melolontha may be found on canopy of Quercus
Remarks: season: 5-6

Plant / resting place / on
swarming adult of Melolontha melolontha may be found on canopy of Broadleaved trees
Remarks: season: 5-6

Animal / pathogen
Steinernema carpocapsae infects larva of Melolontha melolontha

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Adults are active fliers at dusk onwards. They feed on leaves after dark and rest on trees during the day.They only live for about a month in all and can be eaten by owls and bats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Early larval development takes approximately 4 to 6 weeks.  Larvae slow development over the winter, and in mid-April they suddenly spring back to activity and eat until October. They then hibernate until the third year, when they resume feeding in July and become fully mature in August. However, the fully mature adults do not become active until the following spring, giving the cockchafer a lengthy life cycle.

Development - Life Cycle: metamorphosis

  • Blum, M. 1985. Fundamentals of Insect Physiology. New York: John Wiley and Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The reproductive cycle of the cockchafer is lengthy and triggered by a combination of hormones and environment. Environmental factors, such as the time of day and season trigger endocrines in females. Females in turn send out powerful pheromones, which males detect with their large antennae. Mating occurs typically in late May and early June. Females deposit eggs in a path opposite to that of the pre-mating flight.

After copulation, eggs are deposited about 20 at a time in soft soil.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (Internal ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Melolontha melolontha

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Melolontha melolontha

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATATTTCCTATTTGGTAGATGAGCTGGAATAGTAGGAACATCTTTAAGATTACTAATTCGTGCAGAACTAGGAAATCCTGGAACACTAATCGGTGAT---GATCAAATTTATAATGTAATTGTTACAGCCCATGCTTTTGTTATAATTTTCTTCATAGTCATACCTATTATAATTGGGGGATTCGGCAATTGACTTGTCCCTCTAATACTCGGCGCCCCTGATATAGCATTCCCCCGAATAAATAACATAAGATTTTGACTACTCCCCCCATCCTTAAGCCTTTTACTTATAAGAAGATTAGTTGAAAACGGTGCAGGAACCGGTTGAACAGTTTACCCGCCACTCTCATCAAATATTGCCCATAGAGGAGCCTCAGTTGACTTAGCAATCTTTAGATTACATTTAGCCGGAATCTCTTCCATTCTAGGAGCAGTAAATTTTATTACTACAGTAATCAACATACGTTCCAAAGGAATAACCTTTGATCGTATACCCCTTTTTGTCTGATCTGTCGCCTTAACTGCCCTTCTCCTTTTACTTTCCTTACCAGTTTTAGCAGGAGCTATCACAATACTCTTAACTGACCGTAATATTAACACTTCTTTTTTTGACCCAGCAGGAGGGGGAGATCCAATTTTATACCAACACTTATTCTGATTTTTTGGCCATCCCGAAGTTTATATTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

This animal requires no special status.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

No action has been taken to conserve this species because when present in large numbers it can be a serious pest.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although this species is not threatened at present, it has declined significantly and is no longer the serious pest it once was. This is thought to be due to mechanical cultivation, which kills the larvae (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Conservation action is not required for this species (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Adults generally only cause damage when they are found in extremely large populations. Larvae, however, are reviled in gardens and farms everywhere they inhabit. This is because the larvae gorge themselves for over 3 years on the fresh rootlets of plants and trees. This can wipe out crops and weaken older trees.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

No positive human benefit has yet been attributed to the common cockchafer.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!