Overview

Brief Summary

Loa loa is one of the eight parasitic nematode (roundworm) species that account for most cases of filariasis in humans (this form of filariasis is sometimes known as loiasis), although it is responsible for less morbidity than are many of the other seven species (notably, Wuchereria bancrofti and Brugia malayi, which cause lymphatic filariasis, and Onchocerca volvulus, which causes onchocerciasis (river blindness)). Loa loa is endemic to Africa. (Centers for Disease Control Parasites and Health website) In particular, loiasis is really endemic to just a few Central and West African countries, where it afflicts around 20 million people (Hoerauf 2009). This nematode is often known as the African eye worm because the adult worm can sometimes be seen moving through the sclera (white portion) of the eye. Migration causes severe eye pain, inflammation, and sometimes blindness and may take a few minutes or up to several hours. Most cases of loiasis are asymptomatic. The first clinical signs may appear within a few months of infection, but often do not appear for more than a decade. (Padgett and Jacobsen 2008 and references therein)

The primary vectors for Loa loa filariasis are two day-biting Chrysops deerflies, C. silacea and C. dimidiata. During a blood meal, an infected fly introduces third-stage filarial larvae onto the skin of the human host, where they penetrate into the bite wound. The larvae develop into adults that commonly reside in subcutaneous tissue, where they can live for several years. The female worms measure 40 to 70 mm in length and 0.5 mm in diameter, whereas the males measure 30 to 34 mm in length and 0.35 to 0.43 mm in diameter. Adults produce microfilariae measuring 250 to 300 μm by 6 to 8 μm, which are sheathed and have diurnal periodicity. Microfilariae have been recovered from spinal fluids, urine, and sputum. During the day they are found in peripheral blood, but during the noncirculation phase, they are found in the lungs. The fly ingests microfilariae during a blood meal. After ingestion, the microfilariae lose their sheaths and migrate from the fly's midgut through the hemocoel to the thoracic muscles of the arthropod. There the microfilariae develop into first-stage larvae and subsequently into third-stage infective filariform larvae. The third-stage infective larvae migrate to the fly's proboscis and, just a few weeks after the microfilariae were ingested by the fly, can infect another human when the fly takes a blood meal. (Centers for Disease Control Parasites and Health website)


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Loa loa inhabits rainforests in West Africa and equatorial Sudan.

Biogeographic Regions: ethiopian (Native )

  • Roberts, L., J. Janovy. 2000. Foundations of Parasitology 6th ed.. Boston: McGraw Hill.
  • Thompson, M., V. Obsomer, M. Dunne, S. Connor, D. Molyneux. 2000. Satellite mapping of Loa loa prevalence in relation to ivermectin use in west and central Africa. Lancet, 356: 1077-1078.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Loa loa is cylindrical, has a cuticle with three main outer layers made of collagen and other compounds. The outer layers are non-cellular and are secreted by the epidermis. The cuticle layer protects the nematodes so they can invade the digestive tracts of animals. The worms molt four times, the first two before hatching, and then before their adult stage.

Nematodes have longitudinal muscles along the body wall. The muscles are obliquely arranged in bands. Dorsal, ventral and longitudinal nerve cords are connected to the main body of the muscle.

Loa loa adults are small, thin worms ranging in length from 20-70 mm long and 350-430 micrometers wide. Females are typically larger than males. The head of Loa loa is simple and lacks lips. The tail is blunt. Loa loa juveniles look similar to adults, but are much smaller.

Range length: 20 to 70 mm.

Other Physical Features: ectothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
  • Barnes, R. 1987. Invertebrate Zoology. Orlando, Florida: Dryden Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Loa loa live in areas with hot, wet climates, such as rainforests and swamps. They are transfered by tabinid flies to their human hosts, where they live in subcutaneous tissues, although they have been known to migrate deeper into the body.

Habitat Regions: tropical ; freshwater

Terrestrial Biomes: rainforest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

Wetlands: marsh ; swamp

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Gardon, J., N. Gardon-Wendel, Demanga-Ngangue, J. Kamgno, J. Chippaux. 1997. Serious reactions after mass treatment of onchocerciasis with ivermectin in an area endemic for Loa loa infection. Lancet, 350: 18-22.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Loa loa is an obligate endoparasite, feeding on fluids in the tissues of humans. Pharyngeal glands and intestinal epithelium produce digestive enzymes to feed on the hosts’ body fluids. Extracellular digestion begins within the lumen and is finished intracellularly. Tabanid flies serve as intermediate hosts.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Loa loa is an obligate endoparasite, feeding on fluids in the tissues of humans. Tabanid flies serve as intermediate hosts.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

These parasites are usually not preyed on directly, but are ingested. Larval mortality is high as most of the parasites do not reach appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Nematodes within the Secernentea have phasmids, which are unicellular glands. Phasmids likely function as chemoreceptors. Females may produce pheromones to attract males.

Nematodes in general have papillae, setae and amphids as the main sense organs. Setae detect motion (mechanoreceptors), while amphids detect chemicals (chemoreceptors).

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

After mating, female Loa loa give birth to microfilariae. The microfilariae migrate into the blood stream. At this stage, they can be ingested by any number of deer fly species that feed on the infected host. In the fly, the microfilariae develop in the fat body until reaching the juvenile stage. The infective juvenile Loa loa move to the mouthparts of the fly so that when it slices open a human to feed, the Loa loa may again invade a human host. After a year of development in their definitive host, the Loa loa are adults that may begin the cycle anew.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Adults may live up to 15 years or more.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Females may produce a phermomone to attract males. The male coils around a female with his curved area over the female genital pore. The gubernaculum, made of cuticle tissue, guides spicules which extend through the cloaca and anus. Males use spicules to hold the female during copulation. Nematode sperm are amoeboid-like and lack flagella.

Key Reproductive Features: sexual ; fertilization (Internal ); ovoviviparous

Parental Investment: pre-fertilization (Provisioning)

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
  • Barnes, R. 1987. Invertebrate Zoology. Orlando, Florida: Dryden Press.
  • Roberts, L., J. Janovy. 2000. Foundations of Parasitology 6th ed.. Boston: McGraw Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loa loa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTTTTTTGTGGAATGACTTTTGGTAATGTTTTAAAGCAGAGTATTATTAATACTGTGAATCATAAGACTATTGGTACTTATTATATTGTTCTTGGTTATTGAGCTGGTTTGGGTGGATCTGTATTGTCTATGATTATTCGTTTTGAATTGTCCAGTCCTGGTGGTTATTTATTTTTTGGTAGTGGTCAGGTTTATAATTCTGTATTAACTATGCATGGTGTTTTGATGATTTTTTTTGTTGTTATGCCTATTTTGATTGGTGGTTTTGGTAATTGGATGTTGCCTATTATGTTGGGTTCTCCTGAAATGGCTTTTCCTCGTTTGAATGCTTTGTCTTTTTGGTTTACTTTTGTAGCTTTGTTAATGGTTTATCAGTCTTTTTTTATTGGAGGAGGACCTGGTAGTAGTTGAACTTTTTATCCTCCTTTAAGGATTGAAGGTCAACCTGAGATATCTTTGGATGTTATAATTTTAGGTTTGCATACTGTTGGTATTGGGTCTTTATTAGGTTCTATTAATTTTATAGTTACAGTTCAGAATATGCGTTCTATTGCTGTTACATTAGATCAGATTAGTATATTTGTTTGAACTTCTTATTTAACTTCTTTTTTGTTGTTATTGTCTGTTCCTGTTTTGGCTGGTTCTCTTTTATTTTTGTTGTTTGATCGTAATTTTAATACTTCTTTTTATGATACTAAGAAGGGAGGAAATCCTTTACTTTATCAGCATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATGTCATTATTTTGCCTGTTTTTGGGATTATTAGTGAGGCTGTTTTGTTTTTGACTGATAAGGATCGTTTATTTGGTCAAACTAGTATAACTTTTGCTTCTATTTGAATTGCTGTTTTGGGTACTTCTGTTTGAGGTCATCATATATATACTGCTGGTCTTGATATTGATACTCGTACTTATTTTAGTGCTGCTACTATGATTATTGCTATTCCTAGAGCTGTTAAGGTTTTTAATTGATTAGGTACTTTTTTTGGCACCAACCAGAAATTTCAGCCTTTGTGATGTTGGACTTATAGTTTTATTTTTCTTTTTACTGTTGGTGGTTTAAGAGGTATTATTTTAAGTGCTGCTAGTTTAGATGTTGTTTTACATGATACTTATTATGTTGTGGCTCATTTTCATTATACTTTGAGTCTTGGTGCTGTTTATGGTATTTTTTGTGGTTTTTGTTTGTGATTGCCTTATATGTATGGTGTTTCTTTTGATGGTACTATAATAATTGCTGTATTTTTATGTTTTTTTATTGGTACTAATATAACTTTTTTTCCTATGCATTTTGCTGGTATACAGGGTATGCCTCGTAAGATTTTGGATTATCCTGATTGTTATTCTATATTTCAGATTGTTTCTTCTATTGGGTCTGTTATTACTTTTATTGGTTTTATTTTATTTAATTATTTGTTAGTTGATTCTATTTTTTTTTCTCGTTATTTGGGTATTTCTTTTTATAACGGTCATAGTCCTGCTTATGTTAGTAATGTTCCTCCTTTGCCAGATTCTTTTGTTGAAGAATGTTTAAATGTTGGTGTTCATTGAAAGGTGTTGAATAATAATACTCCTTCTTATAGTTATCGTCGTGTTGGTTATGGTTATTATAGAAAGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Loa loa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Loa loa is a serious parasite of humans in rural areas of West Africa. When Loa loa migrate into deeper tissues of a host, they can cause encephalitis, sometimes leading to death. Other pathogenic effects include joint pain caused by swelling when a worm stays near a joint for a period of time and damage to the eyes as the worm crawls through the cornea and conjunctive tissues.

Negative Impacts: injures humans (causes disease in humans )

  • Blum, J., A. Wiestner, P. Fuhr, C. Hatz. 2000. Encephalopathy following Loa loa treatment with albendazole. Acta Tropica, 78: 63-65.
  • Chippaux, J., M. Boussinesq, J. Gardon, N. Gardon-Wendel, J. Ernould. 1996. Severe adverse reaction risks during mass treatment with ivermectin in loiasis-endemic areas. Parasitology Today, 12: 448-450.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Loa loa

Loa loa is the filarial nematode (roundworm) species that causes Loa loa filariasis. It is commonly known as the "eye worm". Its geographic distribution includes Africa and India.[1]

L. loa is one of three parasitic filarial nematodes that cause subcutaneous filariasis in humans. The two other filarial nematodes are Mansonella streptocerca and Onchocerca volvulus (causes river blindness).

Maturing larvae and adults of the "eye worm" occupy the subcutaneous layer of the skin – the fat layer – of humans, causing disease. The young larvae develop in horseflies of the genus Chrysops (deer flies, yellow flies), including the species C. dimidiata and C. silacea, which infect humans by biting them.

Biology[edit]

Morphology[edit]

Loa loa worms have a simple body including a head, body, and tail. Males range from 20mm to 34mm long and 350μm to 430μm wide. Females range from 20mm to 70mm long and are about 425μm wide.[1]

Life cycle[edit]

Three species involved in the life cycle include the parasite Loa loa, the fly vector, and the human host:[2]

  • A vector fly bites an infected human host and ingests microfilariae.
  • Microfilariae move to the fat body of the insect host.
  • Microfilariae develop into first stage larvae, second stage, then third stage larvae.
  • Third stage larvae (infective) travel to the proboscis of fly.
  • An infected vector fly bites an uninfected human host and the third stage larvae penetrates the skin and enters human subcutaneous tissue.
  • Larvae mature into adults, who produce microfilariae that have been found in spinal fluid, urine, peripheral blood, and lungs.

Disease[edit]

Pathogenesis[edit]

Loa loa parasites infect human hosts by travelling from the entry site through subcutaneous tissues and causing inflammation in the skin wherever they travel. If a parasite stops in one place for a short period of time, the human host will suffer from local inflammation known as Calabar swellings. These are localized, tense, inflammatory pruritic subcutaneous edema seen in joints of extremities, lasting for 1–3 days. They represent areas of angioedema resulting from a host response to allergens released by the maturating worm and its metabolic products.[3] Calabar swellings often occur in the wrist and ankle joints but disappear as soon as the parasite begins to move again. Parasites can also travel through and infect the eye, causing the swelling of the eye. Common symptoms include itching, joint pain, fatigue, and death.[1]

Diagnosis and treatment[edit]

The main methods of diagnosis include the presence of microfilariae in the blood, the presence of a worm in the eye, and the presence of skin swellings. Surgical removal of the worm can easily be performed. The common treatment for the disease is the use of the drug Ivermectin.[1]

Ivermectin has become the most common antiparasitic agent used worldwide but can lead to residual microfilarial load when given in the management of loiasis. High microfilarial loads should be decreased by a course of ivermectin, a prolonged administration of albendazole, or cytapheresis sessions to prevent occurrence of serious adverse events, including fatal encephalopathy induced by dying microfilariae. Cytapheresis is helpful in decreasing very high microfilarial loads up to 75%. Diethylcarbamazine kills both microfilariae and adult worms but has more severe side effects and can be fatal.

References[edit]

  1. ^ a b c d Schmidt, Gerald et al. "Foundations of Parasitology". 7th ed. McGraw Hill, New York, NY, 2005.
  2. ^ "Filariasis". Parasites and Health. Center for Disease Control.
  3. ^ Rivière, E., Kerautret, J., Combillet, F., & Malvy, D. (2012). African Eye Worm. Journal Of Global Infectious Diseases, 4(2), 135-136. doi:10.4103/0974-777X.96782
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!