Overview

Brief Summary

The Dwarf Tapeworm (Hymenolepis nana) is the most commonly encountered tapeworm infecting humans and is encountered worldwide. In temperate regions, its incidence is higher in children and institutionalized groups. It is one of two tapeworm species that cause hymenolepiasis in humans (the other being the Rat Tapeworm, H. diminuta). Adult H. nana are unusually small for tapeworms, measuring just 15 to 40 mm in length.

Eggs of Hymenolepis nana are immediately infective when passed with the stool and cannot survive more than 10 days in the external environment. When eggs are ingested by an arthropod intermediate host (various species of beetles and fleas may serve as intermediate hosts), they develop into cysticercoids, which can infect humans or rodents upon ingestion and develop into adults in the small intestine. A morphologically identical variant, H. nana var. fraterna, infects rodents and uses arthropods as intermediate hosts. When eggs are ingested (in contaminated food or water or from hands contaminated with feces), the oncospheres contained in the eggs are released. The oncospheres (hexacanth larvae) penetrate the intestinal villus and develop into cysticercoid larvae. Upon rupture of the villus, the cysticercoids return to the intestinal lumen, evaginate their scolices, attach to the intestinal mucosa, and develop into adults that reside in the ileal portion of the small intestine and produce gravid proglottids. Eggs are passed in the stool when released from proglottids through the genital atrium or when proglottids disintegrate in the small intestine. An alternate mode of infection consists of internal autoinfection, in which the eggs release their hexacanth embryo, which penetrates the villus, continuing the infective cycle without passage through the external environment. The life span of adult worms is 4 to 6 weeks, but internal autoinfection allows the infection to persist for years.

From Centers for Disease Control Parasites and Health website

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Hymenolepis nana can be found throughout the world, but is usually most common in temperate zones. It is the most common cestode of humans and is found wherever there are human inhabitants.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical ; australian

Other Geographic Terms: cosmopolitan

  • Roberts, L., J. Janovy Jr.. 2000. Foundations of Parasitology, Sixth Edition. MA: Mcgraw-Hill Higher Education.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The adults of the dwarf tapeworm are 25 to 40 mm in length and 1 mm in width (Lapage, 1951). This tapeworm is transparent, and has a long slender neck with segments wider than they are long. The genital pores are unilateral, or on the side of the segment. Each segment contains a single proglottid, which contains a single set of reproductive organs. On the scolex, a retractable rostellum with 20 to 30 hooks can be found (Roberts and Janovy, 2000). The scolex also has four suckers, or a tetrad.

The cysticercoid has a tail, which is made of longitudinal fibers and is spade shaped with the rest of the worm still inside the cyst (Roberts and Janovy, 2000). The eggs of H. nana are round or slightly oval at about 40-60 micrometers X 30-50 micrometers with 4-8 polar filaments spread out between the inner and outer membranes (Ghaffar, 2001). Unlike other taeniid eggs, the eggs of H. nana do not have a striated appearance (Roberts and Janovy, 2000).

Range length: 25 to 40 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Hymenolepis nana can be found wherever humans and rodents live. They have been found in almost all types of terrestrial biomes.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The dwarf tapeworm like all other tapeworms lacks a digestive system and feeds by absorption on nutrients in the intestinal lumen (Cameron, 1956). They have non-specific carbohydrate requirements and it seems like they will absorb whatever is being passed through the intestine at that time (Cameron, 1956). When it becomes an adult, it will attach to the intestinal walls with its suckers and toothed rostellum and have its segments reaching out into the intestinal space to absorb food (Roberts and Janovy, 2000).

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Mus musculus

Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Homo sapiens

Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Mus musculus (albino)

Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Mesocricetus auratus

Animal / parasite / endoparasite
larva of Hymenolepis nana endoparasitises adult of Tenebrio

Animal / parasite / endoparasite
larva of Hymenolepis nana endoparasitises larva of Siphonaptera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

An intermediate host is optional; H. nana can go through its life cycle with only one host or can also go through the normal two-host cycle (Roberts and Janovy, 2000). Some of the hosts that this tapeworm can be found in are humans, rodents and insects (Roberts and Janovy, 2000). The insect hosts of H. nana could be fleas, flour beetles, and other copraphagous (dung eating) insects.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

These animals are probably not preyed on directly but are ingested. Egg and larval mortality are high due to not reaching a suitable host.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cestodes in general have sensory organs in the scolex, which are attached to longitudinal nerves extending down the body. The nerves are attached to organs and the cestodes can detect tactile stimulation.

Communication Channels: tactile

Perception Channels: tactile

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

A gravid proglottid contains fertilized eggs, which are sometimes expelled with the feces (Cameron, 1956). However, most of the time, the egg settles in the microvilli of the small intestine, hatch, and the larvae can develop to sexual maturity without ever leaving the host (Olsen, 1974). An intermediate host is optional; H. nana can go through its life cycle with only one host or can also go through the normal two-host cycle (Roberts and Janovy, 2000). The life cycle can be described as: 1)eggs are ingested by definitive hosts 2)eggs hatch in the duodenum, releasing oncospheres and lie in the lymph channels of the villi 3)oncospheres develops into a cysticercoid, which has a tail and a well formed scolex, and it attaches to the small intestine and matures into an adult 4a)gravid proglottids then release and pass out through feces along with eggs 4b)or eggs can hatch and infect original host and start cycle over or 5)eggs can be ingested by insects or rodents (Roberts and Janovy, 2000).

  • Cameron, T. 1956. Parasites and Parsitism. NY: John Wiley and Sons, Inc..
  • Olsen, O. 1974. Animal Parasites, Third Edition. MD: University Park Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Hymenolepis nana, like all tapeworms, contain both male and female reproductive structures in each proglottid (Roberts and Janovy, 2000). This means that the dwarf tapeworm like other tapeworms is hermaphroditic (Cameron, 1956). Each segment contains 3 testes and a single ovary. When a proglottid becomes old and unable to absorb any more nutrition, it is released and is passed through the host's digestive tract (Roberts and Janovy, 2000). This gravid proglottid contains the fertilized eggs, which are sometimes expelled with the feces (Cameron, 1956). However, most of the time, the egg may also settle in the microvilli of the small intestine, hatch, and the larvae can develop to sexual maturity without ever leaving the host (Olsen, 1974).

Key Reproductive Features: simultaneous hermaphrodite; sexual ; fertilization (Internal )

Parental Investment: pre-fertilization (Provisioning)

  • Cameron, T. 1956. Parasites and Parsitism. NY: John Wiley and Sons, Inc..
  • Olsen, O. 1974. Animal Parasites, Third Edition. MD: University Park Press.
  • Roberts, L., J. Janovy Jr.. 2000. Foundations of Parasitology, Sixth Edition. MA: Mcgraw-Hill Higher Education.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hymenolepis nana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGAGTGCATGATTGTTGATTCCATCGTTGACTTTTTTGATTATTAGTATGTGGTTGGGTGCT------GGAGTTGGATGAACTTTTTATCCACCTTTATCTTCGTCTTTATTTATGAGTAGAAAGGGTGTTGATTTTCTTATGTTTTCTTTACATTTAGCTGGTGTATCTAGAATTTTTAGTTCTATAAATTTTATTTGTACATTATACACTATATTTTGTGATAGGTTA---TATAGACGAACATCTATTATTTTATGGTCTTATCTTTTTACTTCATTGCTTTTGCTTTTTAGACTTCCTGTTTTAGCTGCTGCTATAACGATGTTGTTGTTTGACCGAAAATTTAGTTCTGCTTTTTTTGATCCATTAGGTGGGGGTGATCCTGTTTTATTTCAACATATGTTTTGGTTTTTTGGTCATCCTGAAGTTTATGTTTTAATATTACCGGGTTTTGGTATTATAGGTCATATATGTTTAAGATTGAGTTTAATTCCTGATGCTTTTGGGTTTTATGGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATCATATGTTTACTGTTGGTTTGGATGTTAAGACGGCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hymenolepis nana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hymenolepis nana is the most common cestode parasite of humans in the world (Roberts and Janovy, 2000). It lodges itself in the intestines and absorbs nutrients from the intestinal lumen (Cameron, 1956). In human adults, the tapeworm is more of a nuisance than a health problem, but in small children, many H. nana can be dangerous. Usually it is the larva of this tapeworm that causes the most problem in children (Lapage, 1951). The larva will burrow into the walls of the intestine, if there are enough tapeworms in the child, severe damage can be inflicted. This is done by absorbing all the nutrition from the food the child eats (Lapage, 1951). Usually a single tapeworm will not cause any danger, but in small children, many tapeworms can become a problem (Lapage, 1951). Hymenolepis nana usually will not cause deaths unless in extreme circumstances and usually in young children or in people who have weakened immune systems. In some parts of the world, individuals that are heavily infected are a result of internal autoinfection (Olsen, 1974).

Negative Impacts: injures humans (causes disease in humans ); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hymenolepis nana

Dwarf tapeworm (Hymenolepis nana, previously known as Vampirolepis nana, Hymenolepis fraterna, and Taenia nana) is a cosmopolitan species though most common in temperate zones, and is one of the most common cestodes of humans, especially children.

General considerations[edit]

Marty AM and Neafie RC Hymenolepiasis and Miscellaneous Cyclophyllidiases pages 197- 214 in Meyers WM, Neafie RC, Marty AM, Wear DJ. (Eds) Pathology of Infectious Diseases Volume I Helminthiases. Armed Forces Institute of Pathology, Washington DC. 2000;[1] In 1887 Grassi demonstrated that transmission from rat to rat did not require an intermediate host.[2] Later, in 1921, Saeki demonstrated direct cycle of transmission of H. nana in humans; transmission without an intermediate host. In addition to the direct cycle, Nicholl and Minchin demonstrated that fleas can serve as intermediate hosts between humans.[3]

Morphology[edit]

As its name implies (Greek: nanos – dwarf), it is a small species, seldom exceeding 40 mm long and 1 mm wide. The scolex bears a retractable rostellum armed with a single circle of 20 to 30 hooks. The scolex also has four suckers, or a tetrad. The neck is long and slender, and the segments are wider than long. Genital pores are unilateral, and each mature segment contains three testes. After apolysis gravid segments disintegrate, releasing eggs, which measure 30 µm to 47 µm in diameter. The oncosphere is covered with a thin, hyaline, outer membrane and an inner, thick membrane with polar thickenings that bear several filaments. The heavy embryophores that give taeniid eggs their characteristic striated appearance are lacking in this and the other families of tapeworms infecting humans. Rostellum remains invaginated in the apex of the organ. Rostellar hooklets are shaped like tuning fork. Neck is long and slender, the region of growth. Strobila starts with short, narrow proglottids, followed with mature ones.

Development[edit]

Hymenolepis nana life cycle

Infection is acquired most commonly from eggs in the feces of another infected individual, which are transferred in food, by contamination. Eggs hatch in the duodenum, releasing oncospheres, which penetrate the mucosa and come to lie in lymph channels of the villi. Oncospheres develops into a cysticercoid which has a tail and a well formed scolex. It is made of longitudinal fibers and is spade shaped with the rest of the worm still inside the cyst. In five to six days cysticercoids emerge into the lumen of the small intestine, where they attach and mature.

The direct life cycle is doubtless a recent modification of the ancestral two-host life cycle, found in other species of hymenolepidids, because cysticercoids of H. nana can still develop normally within larval fleas and beetles. One reason for facultative nature of the life cycle is that H. nana cysticercoids can develop at higher temperatures than can those of the other hymenolepidids. Direct contaminative infection by eggs is probably the most common route in human cases, but accidental ingestion of an infected grain beetle or flea cannot be ruled out. The direct infectiousness of the eggs frees the parasite from its former dependence upon an insect intermediate host, making rapid infection and person-to-person spread possible. The short life span and rapid course of development also facilitate the spread and ready availability of this worm.

Reproduction[edit]

An egg of dwarf tapeworm

Hymenolepis nana, like all tapeworms, contains both male and female reproductive structures in each proglottid. This means that the dwarf tapeworm like other tapeworms is hermaphroditic. Each segment contains 3 testes and a single ovary. When a proglottid becomes old and unable to absorb any more nutrition, it is released and is passed through the host's digestive tract. This gravid proglottid contains the fertilized eggs, which are sometimes expelled with the feces. However, most of the time, the egg may also settle in the microvilli of the small intestine, hatch, and the larvae can develop to sexual maturity without ever leaving the host.

Behavior[edit]

The dwarf tapeworm like all other tapeworms lacks a digestive system and feeds by absorption on nutrients in the intestinal lumen. They have non-specific carbohydrate requirements and it seems like they will absorb whatever is being passed through the intestine at that time. When it becomes an adult, it will attach to the intestinal walls with its suckers and toothed rostellum and have its segments reaching out into the intestinal space to absorb food.

Pathology and clinical manifestations of hymenolepiasis[edit]

Hymenolepis nana lodges itself in the intestines and absorbs nutrients from the intestinal lumen. In human adults, the tapeworm is more of a nuisance than a health problem, but in small children, many H. nana can be dangerous. Usually it is the larva of this tapeworm that causes the most problem in children. The larva will burrow into the walls of the intestine, if there are enough tapeworms in the child, severe damage can be inflicted. This is done by absorbing all the nutrition from the food the child eats. Usually a single tapeworm will not cause health issues. Hymenolepis nana usually will not cause deaths unless in extreme circumstances and usually in young children or in people who have weakened immune systems. In some parts of the world, individuals that are heavily infected are a result of internal autoinfection.

Symptoms in humans are due to allergic responses or systematic toxaemia caused by waste products of the tapeworm. Light infections are usually symptomless, whereas infection with more than 2000 worms can cause enteritis, abdominal pain, diarrhea, loss of appetite, restlessness, irritability, restless sleep, anal and nasal pruritus. Rare symptoms include anorexia, increased appetite, vomiting, nausea, bloody diarrhea, hives, extremity pain, headache, dizziness and behavioral disturbances. Occasionally epileptic seizures occur in infected children.

Treatment[edit]

The 2 drugs that have been described for the treatment of hymenolepiasis are praziquantel and niclosamide. Praziquantel, which is parasiticidal in a single dose for all the stages of the parasite, is the drug of choice because it acts very rapidly against H. nana. Although structurally unrelated to other anthelminthics, it kills both adult worms and larvae. In vitro the drug produces vacuolization and disruption of the tegument in the neck of the worms, but not in more posterior portions of the strobila. Praziquantel is well absorbed while taken orally, it undergoes first-pass metabolism and 80% of the dose is excreted as metabolites in urine within 24 hours. Preventing fecal contamination of food and water in institutions and crowded areas is of primary importance. General sanitation and rodent and insect control (especially control of fleas and grain insects) are also essential for prevention of H. nana infection. Repeated treatment is required for Hymenolepis nana at an interval of 7-10days.

References[edit]

  1. ^ http://www.afip.org/cgi-bin/description.cgi?item=FS28
  2. ^ Grassi B. Entwicklungscyclus der Taenia nanna. Dritte Praliminarnote. Centralblatt fṻr Bakteriologie und Parasitenkunde 1887;2:305-312.
  3. ^ Marty AM and Neafie RC Hymenolepiasis and Miscellaneous Cyclophyllidiases pages 197- 214 in Meyers WM, Neafie RC, Marty AM, Wear DJ. (Eds) Pathology of Infectious Diseases Volume I Helminthiases. Armed Forces Institute of Pathology, Washington DC. 2000;http://www.afip.org/cgi-bin/description.cgi?item=FS28

Source[edit]

Textbook

1. Chero JC, Saito M, Bustos JA, Blanco EM, Gonzalvez G, Garcia HH. Hymenolepis nana infection: symptoms and response to nitazoxanide in field conditions. Trans R Soc Trop Med Hyg. Feb 2007;101(2):203-5. [Medline].

2. Baron S., (1996). Medical Microbiology. (4th edition). The University of Texas Medical Branch at Galveston,ISBN 0-9631172-1-1.

3. Gerald D. Schmidt, John Janovy, Jr and Larry S. Roberts (2009). Foundations of Parasitology (8th ed). McGraw-Hil. ISBN 0-07-302827-4

4. R. D. PEARSON, and R. L. GUERRANT. Praziquantel: A Major Advance in Anthelminthic Therapy. Ann Intern Med, August 1, 1983; 99(2): 195 - 198.

5. World Health Organization (1995). WHO model prescribing information: drugs used in parasitic diseases (2nd edition). Published by World Health Organization. ISBN 92-4-140104-4

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!