Overview

Brief Summary

The Rat Tapeworm (Hymenolepis diminuta) is infrequently seen in humans, but frequently in rodents. It is one of two tapeworm species that cause hymenolepiasis in humans (the other being the Dwarf Tapeworm, H. nana). Adult H. diminuta measure 20 to 60 cm in length.

Eggs of Hymenolepis diminuta are passed out in the feces of the infected definitive host (rodents, humans). The mature eggs are ingested by an intermediate host (various arthropod adults or larvae) and oncospheres are released from the eggs; these penetrate the intestinal wall of the host and develop into cysticercoid larvae. Tribolium beetles are common intermediate hosts for H. diminuta. The cysticercoid larvae persist through the arthropod's morphogenesis to adulthood. Hymenolepis diminuta infection is acquired by the mammalian host after ingestion of an intermediate host carrying the cysticercoid larvae. Humans can be accidentally infected through the ingestion of insects in pre-cooked cereals or other food items, as well as directly from the environment (e.g., via oral exploration of the environment by children). After ingestion, the tissue of the infected arthropod is digested, releasing the cysticercoid larvae in the stomach and small intestine. Eversion of the scoleces occurs shortly after the cysticercoid larvae are released. Using the four suckers on the scolex (the anterior part of the warm specialized for attachment to the gut wall of the host), the parasite attaches to the small intestine wall. Maturation of the parasites occurs within 20 days and the adult worms reach an average of around 30 cm in length. Eggs are released in the small intestine from gravid proglottids (serially repeated bisexual reproductive segments) that disintegrate after breaking off from the adult worms. The eggs are expelled to the environment in the mammalian host's feces, beginning the cycle again.

From Centers for Disease Control Parasites and Health website

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Hymenolepis diminuta lives in all temperate zones throughout the world.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical ; australian

Other Geographic Terms: cosmopolitan

  • Andreassen, J., E. Bennet-Jenkins, C. Bryant. 1999. Immunology and biochemistry of Hymenolepis diminuta. ADV PARASIT, 42: 223-275.
  • Arai, H. 1980. Biology of the Tapeworm Hymenolepis diminuta. New York: New York Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Hymenolepis diminuta reach 20 to 60 cm, and up to 90 cm . The cestode has a long cylindrical body with 4 suckers and an apical organ at its scolex with no rostellar hooks. Hymenolepis diminuta, along with all cestodes, lacks any trace of a digestive tract, and it absorbs all required substances through its external covering. Posteriorly directed microtriches cover the cestode's tegument, which add to the surface area of the animal and thus to the amount of nutrients it can absorb.

Hymenolepis diminuta, like all other cestodes, has three body sections, a scolex (head), neck, and a strobilus, which is the rest of the cestodes body. The strobilus is divided into many sections called proglottids, each with male and female sexual organs. These are the defining characteristics of cestodes.

Range length: 20 to 60 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Deines, K., . Richardson, G. Conlogue. JUL 1999. Radiographic imaging of the rat tapeworm, Hymenolepis diminuta. JOURNAL OF HELMINTHOL SOC W, 66 (2): 202-205.
  • Roberts, , Janovy. 2000. Foundations of Parasitology 6th ed.. McGraw-Hill Higher Education.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The adult worm lives in the intestine of its host, normally rats but also sometimes dogs and humans. Hymenolepis diminuta passes through the required intermediate arthropod host as a juvenile. Only when the intermediate host is injested by the definitive host will H. diminuta mature. The intermediate arthropod host is normally a grain beetle, and injestion of the intermediate host into the definative host normally occurs in piles of grain, where both rats and beetles live.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

  • Pappas, P. SEP 2000. Allometric growth of the proglottids and strobila of the tapeworm, Hymenolepis diminuta. J HELMINTHOL, 74 (3): 259-265.
  • Shostak, A., K. Smyth. AUG 1998. Activity of flour beetles (Tribolium confusam) in the presence of feces from rats infected with rat tapeworm (Hymenolepis diminuta). CANADIAN JOURNAL OF ZOOLOGY, 76 (8): 1472-1479.
  • Sturdevant, L. 1907. Some Variations in Hymenolepis diminuta.
  • Willis, C., R. Poulin. 1999. Effects of the tapeworm Hymenolepis diminuta on maternal investment in rats. Canadian Journal of Zoology, 77 (6): 1001-1005.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hymenolepis diminuta has no digestive tract, all nutrients needed must be absorbed by the tegument, which is the external covering of the cestode. The cestode is covered in tiny posteriorly directed microtriches which increase the absorbtive area of the tegument. The glycocalyx found on the surface membrane of the microtiches is a layer of carbohydrate-containing macromolecules. Interaction between the glycocalyx and certain molecules has been reported to enhance amylase activity in H. diminuta, inhibit the host trypsin, chymotrypsin, and pancreatic lipase and increase the absorption of cations and adsorbtion of bile salts.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite / endoparasite
tapeworm of Hymenolepis diminuta endoparasitises small intestine of Rattus

Animal / parasite / endoparasite
larva of Hymenolepis diminuta endoparasitises adult of Insecta

Animal / parasite / endoparasite
larva of Hymenolepis diminuta endoparasitises larva of Tenebrio

Animal / parasite / endoparasite
larva of Hymenolepis diminuta endoparasitises adult of Tribolium confusum

Animal / parasite / endoparasite
larva of Hymenolepis diminuta endoparasitises larva of Pyralis farinalis

Animal / parasite / endoparasite
larva of Hymenolepis diminuta endoparasitises larva of Nosopsyllus fasciatus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

The adult worm lives in the intestine of its host, normally rats but also sometimes dogs and humans. Hymenolepis diminuta passes through the required intermediate arthropod host as a juvenile. Only when the intermediate host is injested by the definitive host will H. diminuta mature. The intermediate arthropod host is normally a grain beetle, and injestion of the intermediate host into the definative host normally occurs in piles of grain, where both rats and beetles live.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There is an extremely low chance for each egg to reach reproductive maturity and that is why H. diminuta lays so many eggs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cestodes in general have sensory organs in the scolex, which are attached to longitudinal nerves extending down the body. The nerves are attached to organs and the cestodes can detect tactile stimulation.

Communication Channels: tactile

Perception Channels: tactile

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The life cycle of H. diminuta involves rodents (rats primarily) as the definitive host and beetles (flour and grain beetles, Tribolium spp. and Tenebrio spp., respectively) as the intermediate host. The tapeworm's eggs are passed in the rat's feces, and beetles are infected when they eat the eggs; the metacestode stage in the beetle is called a cysticercoid. The rat is infected when it eats an infected beetle. Once the egg is digested by the intermediate host arthropod, the oncosphere, a fully developed larva contained in the egg, is released into the intermediate host. Its function is to migrate to the haemocoel (body cavity) of the insect where it will grow and differentiate into an encapsulated juvenile worm. This stage, the cysticercoid, is dormant and resides in the insect until both are eaten by a foraging rat. Within the definitive hosts' stomach and intestine, the larval worm responds to chemical signals and excysts. It then invades the intestinal lumen, evaginates its scolex, attaches to the intestinal mucosa and develops into an adult.

Once the adult H. diminuta is embedded in the host, it can produce over 250,000 eggs per day. Thus, over a period of slightly over a year, a single tapeworm could produce a hundred million eggs and if all these eggs reached maturity, it would be equal to 20 tons of tapeworm tissue. There is an extremely low chance for each egg to reach reproductive maturity and that is why H. diminuta lays so many eggs.

  • Pappas, P., K. Ruthoford, A. Barley. 1999. Thermal tolerance of Hymenolepis diminuta eggs does not limit the parasite's distribution. Journal of Helminthology, 73 (1): 85-86.
  • Ohio State University, 2001. "Hymenolepis diminuta" (On-line). Parasites and Parasitological Resources. Accessed 10/14/04 at http://www.biosci.ohio-state.edu/~parasite/hymenolepis_diminuta.html.
  • University of Aberdeen, 1997. "The life cycle, developmental sequence and crowding effect of the tapeworm *Hymenolepis diminuta*" (On-line). Biological and Soil Science. Accessed 10/14/04 at http://vcs.abdn.ac.uk/BIO_SOIL/parasite/contents.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Hymenolepis diminuta has both male and female reproductive organs in the same individual. Each segment has one complete set of male and female sex organs. As the segments move toward the posterior end of the strobilus, first the male organs mature, and produce sperm that are stored until the maturation of the ovary.  Once the adult H. diminuta is embedded in the host, it can produce over 250,000 eggs per day. Thus, over a period of slightly over a year, a single tapeworm could produce a hundred million eggs and if all these eggs reached maturity, it would be equal to 20 tons of tapeworm tissue. There is an extremely low chance for each egg to reach reproductive maturity and that is why H. diminuta lays so many eggs.

Recent studies have been done on the temperature tolerance of Hymenolepis diminuta eggs. The tapeworm's eggs survived at higher and lower temperatures and for longer periods of time than did adult beetles, indicating that the thermal tolerance of the eggs does not limit the parasite's distribution.

Key Reproductive Features: simultaneous hermaphrodite; sexual

Parental Investment: no parental involvement

  • Andreassen, J., E. Bennet-Jenkins, C. Bryant. 1999. Immunology and biochemistry of Hymenolepis diminuta. ADV PARASIT, 42: 223-275.
  • Arai, H. 1980. Biology of the Tapeworm Hymenolepis diminuta. New York: New York Academic Press.
  • Pappas, P., . Barley. APR 1999. Beetle-to-beetle transmittion and dispersal of Hymenolepis diminuta (Cestoda) eggs via the feces of Tenebrio molitor. JOURNAL OF PARASITOLOGY, 85 (2): 384-385.
  • Ohio State University, 2001. "Hymenolepis diminuta" (On-line). Parasites and Parasitological Resources. Accessed 10/14/04 at http://www.biosci.ohio-state.edu/~parasite/hymenolepis_diminuta.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hymenolepis diminuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTACGTTAGATCATAAGCGTATTGGCGTTATTTATACATTTTTGGGAGTATGAGCTGGTTTTGTAGGCTTGAGGTTCAGGTTAATTATTCGTATAAATTTTTTGGAGCCTTATTATAAAGTTGTGCCTTTAGATTGTTACAAATTTTTGGTTACTAATCATGGTATTATTATGATTTTTTTCTTTTTAATGCCTATTTTGATTGGTGGGTTTGGTAATTATTTGTTACCTTTATTAGGGGGTTTATCAGACTTAAATTTACCTCGTTTGAATGCCTTAAGGGCTTGATTATTAATTCCTTCTATTATATTCTTAGTTTTTAGAATGTGTATGGGAGCGGGTATTGGCTGAACATTTTATCCTCCTTTATCTTCTTCATTATTTTCAGATAGAAAGGGGATTGATTTTCTTATGTTTTCTTTACATTTAGCTGGTGTTTCTAGAATTTTCAGTTCTATAAAATTTATATGTACTTTGTATACTATTTTTAGTAATAATATCTCTGCTCGTAGTTCTATAGTACTTTGGGCGTATTTGTTTACTTCTATGCTGCTACTGATTACCTTGCCTGTTTTAGCAGCAGCAATTACAATGCTTTTGTTTGATCGTAAATTTAGTTCTGCTTTTTTTGACCCATTAGGAGGTGGAGATCCTGTATTGTTTCAGCATATGTTTTGATTTTTTGGTCACCCAGAGGTTTATGTATTAATTTTACCCGGGTTTGGTATTATTAGACATATTTGTTTAAATTTGAGTTTAATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATTGTTTGTTTAGGTAGAAGTGTTTGAGGGCATCATATGTTTACTGTTGGTTTAGATGTAAAGACGGCAGTGTTCTTTAGATCTGTAACTATGATTATAGGGGTACCTACWGGAATTAAGGTGTTTACTTGGTTATACATGCTTTTAAACTCTAAAGTTAATAAGGGGGATCCTGTTGTTTGATGAATAGTGTCTTTTATCGTGTTATTTAGATTTGGAGGAGTTACAGGAATTATTTTATCTGCATGTGTTTTAGATAAAGTTCTTCATGATACTTGATTTGTTGTTGCTCATTTCCATTATGTTATGTCGTTAGGTTCATATATAAGTATTATTATAATGTTTATTTGATGATGACCTTTAATTACAGGTTTGACTTTAAATAAGAGATTACTTCAGTGTCAATGTATTATTTCTAATATTGGATTTAATTTATGCTTTTTTCCTATGCATTATTTTGGGTTATGTGGTTTACCTCGTCGAGTGTGTATTTATGAGATTAGTTATAATTGGATTAACATGATATGTACAATAGGGTCTTTTATAACAGCGTTTAGTGCATGCTTTTTTATTTTTATATTATGAGAATCGTTGGTTAAAGAAAAAAAGATAATTGGGTATTTTGGTTCTTCTGCTTTGCTAACTAATATGATGCGTTCTGGTCCTTTAGCATGTCATAATAATTATTTTAGTTATTGGCACATAGTTAATTATAGACATGTGTATAAAGGTGCTGTTTATGATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hymenolepis diminuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hymenolepis diminuta is a cestode which sometimes causes infection in humans. Human infection results from eating such foods as dried fruits and precooked breakfast cereals in which the infected grain insects, themselves infected from eating rat or mouse droppings, are present. Some symptoms of infestation in humans include, enteritis, anorexia, headaches, anal pruritus, abdominal distress and small gut irritation. Hymenolepiasis is the term for a human to be infected with either H. diminuta or Hymenolepis nana, a dwarf sister species very closely related to H. diminuta.

Negative Impacts: injures humans (causes disease in humans ); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hymenolepis diminuta

Hymenolepis diminuta, also known as rat tapeworm, is a species of Hymenolepis tapeworm that causes hymenolepiasis. It has slightly bigger eggs and proglottids than H. nana and infects mammals using insects as intermediate hosts. The adult structure is 20 to 60 cm long and the mature proglottid is similar to that of H. nana, except it is larger.

H. diminuta is prevalent worldwide, but only a few hundred human cases have been reported.[1][2][3] Few cases have ever been reported in Australia, United States, Spain, and Italy. In countries such as Malaysia, Thailand, Jamaica, Indonesia, the prevalence is higher.[4][5][6]

Contents

Life cycle

The cycle begins as arthropods ingest the eggs. Arthropods are then able to act as the intermediate host. When ingested, the eggs develop into cysticercoids. As shown in the CDC life cycle, oncospheres hatch and then penetrate the intestinal wall.[7] Rodents can become infected when they eat arthropods. Humans, especially children, can ingest the arthropods as well and therefore become infected via the same mechanism. Rodents, especially rats, are definitive hosts and natural reservoirs of H. diminuta. The intermediate hosts are the coprophilic arthropods (fleas, lepidoptera, and coleoptera). As the definitive host (rats) eats an infected arthropod, cysticercoids present in the body cavity transform into the adult worm. The resulting eggs are then passed through the stool. In recent findings, beetle-to-beetle transmission of H. diminuta can be seen via the feces. Additionally, more infections occur due to this mechanism of egg dispersal.[8]

Prevalence

H. diminuta infection in humans is rare, typically occurring in isolated cases. As such, several studies of H. diminuta exist as case reports describing a single affected individual.

In rural Devghar, India, a place heavily infested with rodents and cockroaches, H. diminuta eggs were found in a 12-year-old girl living in a small village.[9]

In an urban area of Rome, a 2-year-old boy was also infected by H. diminuta. However, in this instance, investigators found no evidence of rodent or other possible sources of infection in the places habitually occupied by the affected boy.[5]

In 1989, a child from St. James Parish, Jamaica was the subject of the first documented case of H. diminuta occurring in Jamaica, West Indies.[10]

Influence on host behavior

In a behavioral study of the beetle Tenebrio molitor with cysticercoids of the rat tapeworm H. diminuta, findings suggested that the parasite impairs a beetle's ability to conceal itself. The study followed a rat and a beetle infected with the parasite. Infected beetles were slower than the control group; however, they still maintained the same learning level. In the initial phase of infection, the beetle was in high stress. As time progressed, this did not worsen their ability to learn. Overall, the training experiment portrayed that infected beetles were unable to hide from the rat, illustrating the high impact the parasite had on its host, the beetle.[11]

Symptoms

H. diminuta is often asymptomatic. However, abdominal pain, irritability, itching, and eosinophilia are among the existing symptoms in a few of the reported cases.

Treatment

Since data regarding praziquantel treatment of H. diminuta is sparse, scientists have recommended that every case and treatment of H. diminuta be reported for development of protocols and parasitological purposes.[4]

A 2-year-old Italian boy affected by tuberous sclerosis was infected by H. diminuta. Due to concerns over his neurological condition, the boy was treated with niclosamide rather than praziquantel. In this case, niclosamide treatment proved to be successful.[5]

Notes

  1. ^ Lo CT, Ayele Y, Birrie H. Helminth and snail survey in Harerge region of Ethiopia with special reference to Schistosomiasis. Ethiop Med J 1989;27:73-83.
  2. ^ McMillan B, Kelly A, Walkar JC. Prevalence of Hymenolepis diminuta infection in man in the New Guinea Highlands. Trop Geogr Med 1971;23:390-2.
  3. ^ Mercado R, Arias B. Infections by Taenia sp and other intestinal cestodos in patients of consultorios hospitals and the public sector north of Santiago de Chile (1985–1995). Bol Chil Parasitol 1995:50:80-3.
  4. ^ a b Tena D, Pιrez Simón M, Gimeno C, Pιrez Pomata MT, Illescas S, Amondarain I, et al. Human infection with Hymenolepis diminuta : Case report from Spain. J Clin Microbiol 1998;36:2375-6.
  5. ^ a b c Marangi M, Zechini B, Fileti A, Quaranta G, Aceti A. Hymenolepis diminuta infection in a child living in the urban area of Rome, Italy. J Clin Microbiol 2003;41:3994-5.
  6. ^ Kan SK, Kok RT, Marto S, Thomas I , Teo WW. The first report in Hymenolepis diminuta infection in Sabah, Malaysia. Trans R Soc Trop Med Hyg 1981;75:609.
  7. ^ CDC H. diminuta life cycle. Accessed online April 2009 at: http://www.dpd.cdc.gov/DPDx/HTML/ImageLibrary/G-L/Hymenolepiasis/body_Hymenolepiasis_il8.htm
  8. ^ Pappas, P. W., and A. J. Barley. 1999. Beetle-to-beetle transmission and dispersal of Hymenolepis diminuta (Cestoda) eggs via the feces of Tenebrio molitor. J. Parasitol. 85:384-385.
  9. ^ Watwe S, Dardi CK. Hymenolepis diminuta in a child from rural area. Indian Journal of Pathology & Microbiology 2008; 51(1): 149-150.
  10. ^ Cohen IP. A case report of Hymenolepis diminuta in a child in St James Parish, Jamaica. J La State Med Soc 1989;141: 23-4.
  11. ^ Sheiman IM, Shkutin MF, Terenina NB, Gustafsson MK. A behavioral study of the beetle Tenebrio molitor infected with cysticercoids of the rat tapeworm Hymenolepis diminuta. Naturwissenschaften. 2006 Jun;93(6):305-8. Epub 2006 Mar 23.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!