Overview

Brief Summary

North American Ecology (US and Canada)

Mostly residential in North America where habitat is SEMI-WOODED AREAS, LOW MOIST SPOTS (Scott 1986). Host plants are largely restricted to one genus with most known hosts from Asimina. Hosts are usually shrubs. Eggs are laid on the host plant singly. Individuals overwinter as pupae. There are two flights each year with the approximate flight time MAY1-JUL31 in the northern part of the range and MAR1-DEC31 in the southern part of their range (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Eurytides marcellus range throughout the eastern United States, although are most abundant in the southeast.

Biogeographic Regions: nearctic (Native )

  • Pyle, R. 1981. The Audubon Society Field Guide to North American Butterflies. New York, New York: Alfred A. Knopf, Inc..
  • Tveten, J., G. Tveten. 1996. Butterflies of Houston and Southeast Texas. Austin, Texas: University of Texas Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Central Pennsylvania west to eastern Great Plains south through most of Florida and into Texas. Very rare stragglers as far as New England.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The zebra swallowtail butterfly has a wing span of 5-9 cm. It has long, triangular wings with swordlike tails. The color and size varies between spring and summer butterflies. The early spring zebra swallowtail is smaller with pale greenish-white wings which are crossed by black stripes and bands. They also have shorter tails. The summer zebra swallowtail is larger with light blue-green wings, which are crossed by black stripes and bands, and have longer tails. The hindwings of both the spring and summer zebra swallowtail have two deep blue spots at the base and a red spot closer to the body.

Caterpillars are generally hairless. They have a forked gland called the osmeterium that can protrude from the back of the head if the butterfly is alarmed. This releases a bad smell that is used as defense mechanism. There are two color morphologies of caterpillars. The first is green with yellow and black bands, and the other is dark brown with orange and white bands.

Range wingspan: 5 to 9 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Parenti, U. 1977. The World of Butterflies and Moths. New York, New York: G. P. Putman's Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The zebra swallowtail prefers corridors of wooded land alongside bodies of water such as riversides, lakeshores, marshes and open moist woods.

Habitat Regions: temperate

Terrestrial Biomes: forest

Other Habitat Features: riparian

  • Holland, W. 1910. The Butterfly Book. Garden City, New York: Doubleday, Page and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Meadows, riversides, lakeshores and marshes; broad-leaved woodlands, virtually anywhere that pawpaw grows. Also dry pine or pine-oak woods at least in Florida with dwarf pawpaw. Almost any habitat with adequate foodplants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The zebra swallowtail rarely strays away from the habitats where various species of pawpaw are found. The common food plants for the larvae are the pawpaw and dwarf pawpaw. Some larvae will eat other caterpillars found on the same plant. The adult zebra swallowtail will eat nectar from a variety of flowers. Adults generally eat from taller flowers, because they have a long, flexible "tongue" called a proboscis and can feed from longer, tubed flowers.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; nectar

Primary Diet: herbivore (Folivore , Nectarivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Mostly residential in America north of Mexico (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

In the life cycle of the butterfly, it takes about one month for the zebra swallowtail to mature from an egg to an adult. The chrysalis, or pupa, is attached to a stem or leaf by the tail and by a girdle of silk around the thorax. It hangs head upward in this position.

Development - Life Cycle: metamorphosis

  • Parenti, U. 1972. Butterflies and Moths. London: Orbis Publishing Limited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

An adult Eurytides marcellus butterfly can live up to 6 months in its natural environment.

Range lifespan

Status: wild:
6 (high) months.

Typical lifespan

Status: wild:
6 (high) months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males usually patrol places near host plants searching for females. Small aggregations of patrolling males often form close to mud puddles or moist stream banks.

Female zebra swallowtails lay their eggs singly on the underside of pawpaw leaves.

Key Reproductive Features: fertilization (Internal ); oviparous

  • Holland, W. 1910. The Butterfly Book. Garden City, New York: Doubleday, Page and Company.
  • Parenti, U. 1972. Butterflies and Moths. London: Orbis Publishing Limited.
  • Tveten, J., G. Tveten. 1996. Butterflies of Houston and Southeast Texas. Austin, Texas: University of Texas Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eurytides marcellus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGAAAATGACTTTATTCAACAAATCATAAGGATATTGGAACATTATATTTTATTTTTGGTATTTGATCTGGGATAATTGGAACTTCATTAAGAATATTAATTCGTACTGAATTAGGTAATCCTGGCTCATTAATTGGTGAT---GATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATATTAGGAGCCCCTGACATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATTCTTCTTATTTCTAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTCTATCCCCCTCTTTCATCAAATATTGCTCATAGAGGAAGTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAACTTCATTACTACCATTATTAATATACGAATTAATAATATATCCTTTGATCAAATACCTCTATTTGTATGAGCAGTTGGAATTACAGCTTTACTTTTACTATTATCTTTACCTGTTTTAGCAGGTGCCATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGATCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGTATAATTTCACATATCATTTCTCAAGAAAGAGGAAAAAAGGAAACATTTGGATGTTTAGGAATAATTTATGCTATAATATCAATTGGATTACTAGGTTTTATTGTATGAGCTCATCATATATTTACAGTTGGTATAGATATTGATACACGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eurytides marcellus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

This butterfly needs no special protective status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Biological Research Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Needs: None.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Currently it does not adversely affect humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Economic benefits from this species have yet to be discovered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!