Overview

Brief Summary

Biology

Przewalski's horse feeds on grasses and other plants, while in captivity it also takes hay and grain (3). Most of the day is spent foraging, as it feeds on food with a low nutritional content. In the wild, Przewalski's horse occurred in family groups led by a dominant stallion, juveniles were ousted and the males formed their own bachelor groups before attempting to take over a band of females (5). In captivity, births occur in April/May but in the wild the season is later and more likely to be May/June (6). Gestation takes between eleven and twelve months and foals are able to stand as soon as one hour after birth (3). A week after giving birth, females come into heat and will mate again (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Classified as Extinct in the Wild, Przewalski's horse is the last true wild horse, and the only ancestor of the domestic horse that has survived to the present day (2). The common name refers to the Russian explorer Nikolai Przewalski who first discovered the subspecies in the 1870s (2). This wild horse has a stocky body with robust, short legs (2), a short neck and a powerful jaw (3). The back and sides are dun to greyish-brown in colour, the head has a mealy nose and there is a dark stripe along the back (6). These horses have erect manes with no forelock and only the lower part of the tail is covered with long black hair; the upper part of the dock having shorter, light coloured hairs (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Until the late 18th Century, this species ranged from Germany and Russian Steppes east to Kazakhstan, Mongolia and northern China. After this time, the species went into catastrophic decline. Wild animals survived in eastern Europe (Poland, Belarus, Lithuania and Germany) through the eighteenth century, with the last wild individuals possibly killed in 1814 (Novak 1999). The Plains Tarpan (Equus ferus ferus), lived on the steppes of southern Russia and the Ukraine. The last wild population of Przewalski’s Horse survived until recently in southwestern Mongolia and adjacent Gansu, Xinjiang, and Inner Mongolia (China). Wild horses were last seen in 1969, north of the Tachiin Shaar Nuruu in Dzungarian Gobi Desert in Mongolia (Paklina and Pozdnyakova 1989).

Since the 1990s, reintroduction efforts have started in Mongolia, China, Kazakhstan and Ukraine; Mongolia is the only country where truly wild reintroduced populations exist within its historic range. Reintroductions in Mongolia began in Takhin Tal Nature Reserve in the Dzungarian Gobi Desert (9,000 km2) and Hustai National Park in Mongol Daguur Steppe (570 km2) in 1994 (King and Gurnell 2005). A third reintroduction site, Khomiin Tal, (2,500 km2), in the Great Lakes Depression, was established in 2004, as a buffer zone to the Khar Us Nuur National Park in Valley of the Lakes (C. Feh pers. comm.).

All living wild horses belong to the subspecies Equus ferus przewalskii. The first visual account of Przewalski’s-type Horses date from more than 20,000 years ago. Rock engravings, paintings, and decorated tools dating from the late Gravetian to the late Magdalenian (20,000-9,000 BC), were discovered in caves in Italy, southern France, and northern Spain; 610 of these were horse figures (Leroi-Gourhan 1971). Many cave drawings in France show horses that look like Przewalski’s Horse (Mohr 1971). In prehistoric times, the species probably roamed widely over the steppes of central Asia, China, and Europe (Ryder 1990). The first written accounts originate from Tibet, recorded by the monk Bodowa, who lived around 900 AD. In the “Secret History of the Mongols”, there is also a reference to wild horses that crossed the path of Chinggis Khaan during his campaign against Tangut in 1226, causing his horse to rear and throw him to the ground (Bokonyi 1974). That the wild horse was a prestigious gift, denoting its rarity or that it was difficult to catch, is shown by the presentation of a Przewalski’s Horse to the emperor of Manchuria by Chechen-Khansoloj-Chalkaskyden, an important Mongolian, circa 1630 (Zevegmid and Dawaa 1973). In a Manchurian dictionary of 1771, Przewalski’s Horse is mentioned as “a wild horse from the steppe” (Dovchin 1961).

Przewalski’s Horse was not described in Linnaeus’s “Systema Naturae” (1758) and remained largely unknown in the West until first mentioned by John Bell, a Scottish doctor who travelled in the service of Tsar Peter the Great in 1719-1722 (Mohr 1971). His account of the expedition, “A Journey from St Petersburg to Peking”, was published in 1763. Bell and subsequent observers all located horses known at that time within the area of 85-97° E and 43-50° N (Chinese-Mongolian border). Wild horses were reported again from what is now China by Colonel Nikolai Mikailovich Przewalski, an eminent explorer, at the end of the nineteenth century. He made several expeditions by order of Tsar Alexander the Second of Russia to central Asia, aiming to reach Tibet. While returning from his second expedition in central Asia, he was presented with the skull and hide of a horse shot about 80 km north of Gutschen on the Chinese-Russian border. The remains were examined at the Zoological Museum of the Academy of Science in St Petersburg by I.S. Poliakov, who concluded that they were a wild horse, which he gave the official name Equus przewalskii (Poliakov 1881). Further reports came from the brothers Grigory and Michael Grum-Grzhimailo, who travelled through western China from 1889-1890. In 1889, they discovered a group in the Gashun area and shot four horses: three stallions, and a mare. The four hides and the skulls of the three stallions, together with an incomplete skeleton, were sent back to the Zoological Museum in St. Petersburg. They were able to observe the horses from a short distance and gave the following account: “Wild horses keep in bands of no more than ten, each herd having a dominant stallion. There are other males, too, but they are young and, judging by the hide of the two-year old colt that we killed, the dominant male treats them very cruelly. In fact, the hide showed traces of numerous bites” (Grum-Grzhimailo 1982). Current scientific review of the taxonomy of wild equids (Groves 1986) places Przewalski’s Horse as a subspecies of Equus ferus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 2 people

Average rating: 4.0 of 5

Range

Wild horses (Equus ferus) lived in Europe and Asia 10 - 15 thousand years ago before being pushed back to the furthest limits of their range (5). Przewalski's horse ended up in Asia and the final abode of the subspecies was in southwest Mongolia where the last wild specimen was recorded in 1968 (2). Subsequently, captive-bred individuals have been released in Mongolia (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Geographic Range

Przewalski's wild horse is found in the Altai Mountains of Mongolia (Denver Zoo 1997).

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Historic Range:
Mongolia, China

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Head-body length: 7 feet

Shoulder height: 4 feet

Tail length: 3 feet (Lowry Park Zoo)

Przewalski's wild horse is stocky with short legs and a short neck, looking very pony-like (Burton 1962). Its head is massive with a long face and a powerful jaw. The upper and lower incisors are used for cutting vegetation, while its many hypsodont cheek teeth are used for grinding. With eyes set far back in the skull, it is able to view a wide field, making the only blind spot directly behind its head. The ears are fairly long and erect, but can be moved for the localization of sounds (Lowry Park Zoo).

A stiff, erect blackish mane runs down the back. The legs are slender. The tail hairs are of graduated lengths. In the summer its pelage is short and smooth. back and sides are reddish-brown. The coloration turns to a yellowish white on its belly. In the winter its pelage becomes longer and lighter in color (Denver Zoo 1997).

Range mass: 200 to 300 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Przewalski’s Horse formerly inhabited steppe and semi-desert habitats, as most of this range became degraded or was occupied by livestock, the species became restricted to semi-desert habitats with limited water resources (Van Dierendonck and de Vries 1996). Lowland steppe vegetation was preferentially selected by horses at Hustai National Park and seasonal movements are affected by the availability of the most nutritious vegetation (King and Gurnell 2005).

Because the historic range is not precisely known, there has been much debate about the areas in which Przewalski’s Horses were last seen: was it merely a last refuge or was it representative of the typical/preferred habitat? The Mongolia Takhi Strategy and Plan Work Group (MTSPWG 1993) concluded that the historic range may have been wider but that the Dzungarian Gobi, where they were last seen, was not a marginal site to which the species retreated. Although grass and water are more available in other parts of Mongolia, these areas often have much harsher winters.

An alternative viewpoint of the desert-steppe controversy is that the Eurasian steppe should be considered the wild horse's optimal habitat (Van Dierendonck and de Vries 1996). This would suggest that Przewalski’s Horses were forced into sub-optimal ranges such as the arid Gobi, as the more favourable steppe region was colonized by nomadic pastoralist people over several millennia. Studies of feral horses have shown that they are able to live and reproduce in semi-desert habitats but their survival and reproductive success is clearly sub-optimal compared to feral horses on more mesic grassland (Berger 1986). Van Dierendonck and de Vries (1996) suggest that the wild horse is primarily a steppe herbivore that can survive under arid conditions when there is access to waterholes.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Przewalski's wild horse inhabits grassy deserts and plains in Western Mongolia, but it has been reported to have lived at elevations of up to eight thousand feet (Volf 1990).

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Habitat

Przewalski's horse occupied steppe vegetation and shrubland (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Trophic Strategy

Food Habits

Przewalski's wild horse is an herbivore, eating grass, plants and fruit. It sometimes eats bark, leaves and buds. It is fed hay, grain and alfalfa in the zoos (Denver Zoo 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Its gestation period is from eleven to twelve months, and it gives birth to one foal during April or May. An hour after birth, the foal is able to stand and walk. It begins to graze within a few weeks, but is not weaned for eight to thirteen months. Mating and birth occurs in the same season, since females come into heat seven to eight days after giving birth (Lowry Park Zoo).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Equus przewalskii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA3018-11|AP012269|Equus przewalskii| AACCGCTGACTATTTTCAACTAACCACAAAGACATCGGCACTCTGTACCTCCTATTCGGCGCTTGAGCTGGAATAGTAGGAACTGCCCTA---AGCCTCCTAATCCGTGCTGAATTAGGCCAACCTGGGACCCTACTAGGAGAT---GATCAGATCTACAATGTTATTGTAACCGCCCATGCATTCGTAATAATTTTCTTTATGGTCATACCCATTATAATCGGAGGATTCGGAAACTGATTAGTCCCCCTGATA---ATTGGAGCACCTGATATAGCTTTCCCCCGAATAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTACTTCTTCTCGCTTCCTCAATAATTGAAGCAGGTGCCGGAACAGGCTGAACCGTATATCCTCCTCTAGCTGGAAATCTGGCGCATGCAGGAGCCTCTGTTGACTTA---ACCATTTTCTCTCTCCACCTAGCTGGGGTGTCCTCGATTTTAGGTGCCATCAACTTTATTACCACAATCATTAACATAAAACCACCAGCTCTATCCCAATATCAAACCCCCCTATTCGTTTGATCTGTCCTTATTACGGCAGTACTCCTTCTCCTAGCCCTCCCGGTCCTAGCAGCA---GGCATTACCATGCTTCTCACAGACCGTAACCTAAACACTACTTTCTTCGACCCCGCAGGAGGAGGGGATCCAATCCTTTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTCTATATTCTTATCCTACCAGGCTTCGGTATAATCTCACACATCGTCACATACTACTCAGGTAAAAAG---GAACCTTTTGGCTACATAGGTATAGTGTGAGCTATAATATCCATTGGCTTTCTAGGCTTCATCGTATGGGCTCACCACATGTTTACAGTAGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Equus przewalskii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
D

Version
3.1

Year Assessed
2011

Assessor/s
Boyd, L. & King, S.R.B.

Reviewer/s
Moehlman, P.D. & Zimmerman, W.

Contributor/s

Justification
Previously listed as Extinct in the Wild from the 1960s up to the assessment in 1996. The species was then reassessed as Critically Endangered due to at least one surviving mature individual in the wild. Successful reintroductions have qualified this species for reassessment. The population is currently estimated to consist of more than 50 mature individuals free-living in the wild for the past five years. This taxon is threatened by hybridization with domestic horses, loss of genetic diversity, and disease. As the population size is small, it is vulnerable to stochastic events such as severe weather. Equus ferus przewalskii qualifies as Endangered under criterion D.

History
  • 1996
    Extinct in the Wild
  • 1996
    Extinct in the Wild
  • 1994
    Extinct?
    (Groombridge 1994)
  • 1990
    Extinct?
    (IUCN 1990)
  • 1988
    Extinct?
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Extinct?
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Endangered (Baillie 1996)

The only true wild horse, Przewalski's wild horse has not been seen in its natural habitat since 1968, probably partly as a result of crossing with half-wild domesticated horses and losing its distinct features. It declined drastically because of excessive hunting by people and loss of grazing and watering areas to domestic animials (Nowak 1991).

It has been kept and bred in zoos with only 200 remaining today. In the late twentieth century, Mongolia tried to reintroduce it into the wild (Britannica).

There is a Przewalski's Horse Global Conservation Plan in the works, as humans attempt to preserve the surviving genetic diversity (Swaringen et al. 1997).

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Equus przewalskii , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Extinct in the Wild (EW-) by the IUCN Red List 2002 (1), and listed on Appendix I of CITES (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Population

Population

There are now approximately 306 free-ranging reintroduced and native-born Przewalski’s Horses in Mongolia (Zimmerman 2011). All Przewalski’s Horses alive today are descended from only 13 or 14 individuals, which were the nucleus of a captive breeding program (Bowling and Ryder 1987). Introgression of domestic horse blood happened not only in Halle (#229 dom.Mongol), but also in Askania Nova (#175 Domina; Bowling et al. 2003).

Between 1992 and 2004, 90 captive-born horses were transported to the Takhin Tal/Gobi B reintroduction site in Mongolia (ITG International Takhi Group, Zimmermann 2008). A further three males were translocated from Hustai National Park to Takhin Tal in 2007 (Zimmermann 2008). In 2008 there were approximately 111 free-ranging horses in this population (Zimmerman 2008, Kaczensky and Walzer 2007). In December of 2009 there were 137 individuals in the population, but due to an extremely harsh winter (dzud) the population suffered extreme mortality and by August 2010 only 49 individuals remained (Kaczensky et al. 2010, Zimmerman 2011). From 1992 to 2000, 84 horses were brought to Hustai National Park by the Foundation for the Preservation and Protection of the Przewalski Horse and Mongolian Association for Conservation of Nature and the Environment (MACNE) from reserves in Europe (King and Gurnell 2005). As of the end of 2010 this population was approximately 233 individuals (Zimmerman 2011). A third reintroduction site was started in 2004 at Seriin Nuruu in the Khomiin Tal buffer zone of the Khar Us Nuur National Park in western Mongolia (Association pour le cheval de Przewalski: TAKH). Twenty-two individuals consisting of four pre-established families and one male bachelor group were brought from Le Villaret, France between 2004 and 2005 (C. Feh pers. comm., Zimmermann 2008). In 2010, this population had 24 individuals (Zimmermann 2011).

For the reintroduced population in Mongolia, mature individuals are those that are born in the wild and five years of age. However, individuals born in captivity do not count as mature until they have reproduced in the wild and that offspring is at least five years old. As of 2006 there were 55 mature individuals in the wild (52 (M.F., 26.26) in Hustai, 3 (1.2) in Takhin Tal). In 2007 Hustai had 68 (33.35) mature individuals and Takhin Tal had 11 (3.8) for a total of 79. The reintroduced populations continued to grow and in 2008, Hustai had 90 (39.51) and Takin Tal had 14 (7.7) mature individuals for a total of 104. In 2009, Hustai had a population of 118 mature individuals (52.66) and Takin Tal had 33 (15.18) for a total of 151. The winter of 2009/2010 was very severe and there was high mortality of Przewalski’s Horses, particularly in Takin Tal. In 2010, Hustai’s mature population was 117 (53.64) and Takin Tal’s number of mature individuals was reduced to 17 (8.9). However, the total population of mature individuals was 134. Hence for a period of five years, the mature population of Przewalski’s Horses in Mongolia has been more than 50 individuals. Although this means that the Przewalski’s Horse qualifies as Endangered it should be borne in mind that most of these individuals are from one reintroduction site and climatic perturbations like the extremely harsh winter in 2009/2010 can have very negative effects on small populations.

In China, the Wild Horse Breeding Centre (WHBC) of the Department of Forestry at Kalameili Nature Reserve (KNR) in Xinjiang Uighur Autonomous Region has established a large captive population of approximately 123 Przewalski’s Horses (January 2008, Pantel et al. 2006, Zimmermann et al. 2008). Since 2007 one harem group is roaming free on the Chinese side of the Dzungarian Gobi (Xinjiang); another 60 horses are roaming free during summer time but are returned to the acclimatization pen during the winter (Zimmermann et al. 2008).

The history of population estimates and trends in Przewalski’s Horse has been described by Wakefield et al. (2002). Since the ‘rediscovery’ of the Przewalski’s Horse for western science, western zoos and wild animal parks became interested in this species for their collections. Several long expeditions were mounted to catch animals. Some expeditions came back empty-handed and some had only seen a glimpse of wild Przewalski’s Horses. It proved difficult to catch adult horses, because they were too shy and fast. Capture of foals, with possible killing of the adult harem members, was considered the only option (Bouman and Bouman 1994). Four expeditions that managed to catch live foals took place between 1897 and 1902. Fifty-three of these foals reached the west alive. Between the 1930s and the 1940s only a few Przewalski’s Horses were caught and most died. At least one mare was crossbred with domestic horses by the Mongolian War Ministry (Bouman and Bouman 1994).

Small groups of horses were reported through the 1940s and 1950s in an area between the Baitag-Bogdo ridge and the ridge of the Takhin-Shaar Nuruu (which, translated from Mongolian, means ‘the Yellow Mountain of the Wild Horse’), but numbers appeared to decline dramatically after World War II. The last confirmed sighting in the wild was made in 1969 by the Mongolian scientist N. Dovchin. He saw a stallion near a spring called Gun Tamga, north of the Takhin-Shaar Nuruu, in the Dzungarian Gobi (Paklina and Pozdnyakova 1989). Annual investigations by the Joint Mongolian-Soviet Expedition have since failed to find conclusive evidence for their survival in the wild (Ryder 1990). Chinese biologists conducted a survey in northeastern Xinjiang from 1980 to 1982 (covering the area of 88-90° E and 41°31'-47°10' N) without finding any horses (Gao and Gu 1989). The last native wild populations had disappeared.

The number of living animals in the International Studbook was 1,872 in early 2008. Of the 53 animals recorded in the Studbook as having been brought into zoological collections in the west, only 12 contributed any genes to the current living population. Of these, 11 were brought into captivity between 1899 and 1902 and the last of them died in 1939. The twelfth founder was captured as a foal in 1947. The thirteenth founder was born in 1906 in Halle (Germany) to a wild-caught stallion and a domestic Mongolian mare, and the fourteenth founder is a female born in Askania Nova (Ukraine) to a Przewalski’s Horse stallion and a domestic female of a Tarpan type. Nevertheless, the current population is genetically very close to the original wild horses (Bowling et al. 2003). In addition to animals held in captivity and those already re-introduced, there have been a number of animals released into very large enclosures (reserves). The four largest are in Le Villaret (18.13; Massif Central, France), Buchara (19.17.1; Uzbekistan), the Hortobágy-National Park (77.81; Hungary), and the Chernobyl exclusion zone (32.37; Ukraine) (information as of January 2010, Zimmermann pers. comm.).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Threats

Threats

Major Threats
A number of causes have been cited for the final extinction of Przewalski’s Horses in Mongolia and China. Among these are significant cultural and political changes (Bouman and Bouman 1994), hunting (Zhao and Liang 1992, Bouman and Bouman 1994), military activities (Ryder 1993), climatic change (Sokolov et al. 1992), and competition with livestock and increasing land use pressure (Sokolov et al. 1992, Ryder 1993, Bouman and Bouman 1994). Capture expeditions probably diminished the remaining Przewalski’s Horse populations by killing and dispersing the adults (Van Dierendonck and de Vries 1996). The harsh winters of 1945, 1948, and 1956 probably had an additional impact on the small population (Bouman and Bouman 1994). Increased pressure on, and rarity of waterholes in their last refuge should also be considered as a significant factor contributing to their extinction (Van Dierendonck and de Vries 1996).

For the reintroduced populations, hybridization with domestic horses is the primary threat, accompanied by competition for resources with domestic horses and possibly other livestock. Wherever Przewalski's Horses come into contact with domestic horses, there is a strong risk of hybridization and transmission of diseases. Recently, illegal mining in the protected areas is an additional threat to the viability of these areas. In Hustai National Park, it has been noted that overgrazing of the buffer-zone and continued pressure on the reserve are possible consequences of the enhanced economic activity in this area (Bouman 1998); however, the second phase of the project (1998-2003) paid much more attention to sustainable development of the buffer-zone. In the western section of the Gobi National Park (Gobi B), habitat degradation by nomads and military personnel and their livestock continues; there is no core zone here that is free from human influence all year round. Infectious diseases transmitted from domestic horses, notably Babesia equi, B. caballi and strangles (infection by Streptococcus equi), are a major threat to small reintroduced populations originating from zoos (Roberts et al. 2005, King and Gurnell 2005). Predation on foals by wolves may account for a significant number of mortalities and constitutes a threat to the population growth and continued survival of this taxon (Wit and Bouman 2006, Kaczensky et al. 2004, Kaczensky and Walzer 2007). As was observed during 2009/2010, severe winters can result in significant mortality.

There is concern over loss of genetic diversity after being reduced to a very small population and maintained in captivity for several generations. Sixty per cent of the unique genes of the studbook population have been lost (Ryder 1994). Loss of founder genes is irretrievable and further losses must be minimized through close genetic management. Furthermore, inbreeding depression could become a population-wide concern as the population inevitably becomes increasingly inbred (Ballou 1994). However, correct management of the population can slow these losses significantly, as has been achieved since the organization of the regional captive-breeding programs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Habitat degradation, human activities including hunting and conflict, along with competition with domestic livestock for water and forage are all thought to be responsible for the extinction of Przewalski's horse in the wild (3). The last reported wild individual was seen in 1968 (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Przewalski's Horse is legally protected in Mongolia. It is protected as Very Rare under part 7.1 of the Law of the Mongolian Animal Kingdom (2000). Hunting has been prohibited since 1930, and the species is listed as Very Rare under the 1995 Mongolian Hunting Law (MNE 1996). It is listed as Critically Endangered in both the 1987 and 1997 Mongolian Red Books (Shagdarsuren et al. 1987, MNE 1997), and in the Regional Red List for Mongolia (Clark et al. 2006). The taxon's entire re-introduced range in Mongolia is within protected areas. It is listed on CITES Appendix I (as Equus przewalskii).

The following conservation measures are in place:

  • An International Studbook was produced in 1959, followed in the 1970s by establishment of the North American Breeders Group, which developed into the Species Survival Plan for the Przewalski’s horse. The European Endangered Species Program for this species was accepted in 1986. Many countries now cooperate in these programs to minimize inbreeding and retain genetic diversity in their horse populations.
  • There are three ongoing reintroduction sites in Mongolia.
  • The Status and Action Plan for the Przewalski's Horse (Equus ferus przewalskii) was produced in 2002 (see Wakefield et al. 2002), and provides a more detailed account of the history and ongoing conservation efforts surrounding the species.
  • All three reintroduction sites are fully monitoring their populations and are integrating community livelihood support into their projects.
  • There have been several workshops of stakeholders involved in the reintroduction of Przewalski's Horse to Mongolia (Boyd 2009). At the ‘Endangered Wild Equid Workshop’ held in Ulaanbataar in 2010 the following threats were identified: loss of population due to stochastic events (i.e. severe winter); limited habitat and resources (pasture and water); domestic horses (hybridization, disease, social stress); lack of information, appreciation / awareness, lack of knowledge; and exploitation of resources (i.e. mining). Specific actions needed for each threat category were identified and described.

Conservation measures required:

  • The health of wild and domestic horses should be monitored for disease (Roberts et al. 2005). Standardized techniques should be used to monitor health, fecundity, mortality, habitat utilization and social organization of all populations (Wakefield et al. 2002), and contact between Przewalski's Horses and domestic horses should be kept to a minimum.
  • A single population management approach should be developed.
  • Mongolia currently has the only wild population and an action plan is needed for the country.
  • The genealogy of all horses in Mongolia should be established based on individual micro-satellite data to monitor inbreeding levels, identify hybrids and plan for necessary movements of horses between reintroduction centers to maximize genetic diversity.
  • An authoritative government protocol for hybrids should be developed, to be established before hybridization occurs, and to be made available in each re-introduction centre and to local people (King and Gurnell 2005).
  • Further communication and cooperation between all re-introduction centres would be beneficial.
  • Further training and post-graduate education of staff and biologists involved with this conservation work.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

After the subspecies became Extinct in the Wild, it clung on in a number of small populations in various zoos around the world. In 1977, the Foundation for the Preservation and Protection of the Przewalski's horse (FPPPH) was established in the Netherlands with the long-term aim of returning this ancient horse to the wild (5). At that time there were around 300 horses in zoos and parks and their breeding was managed in order to prevent inbreeding (5). In the 1990s, The Mongolian Association for Conservation of Nature and the Environment (MACNE) and the FPPPH collaborated to reintroduce a number of individuals in small herds into the Hustai National Park in central Mongolia (4). The national symbol was a welcome return to the area and part of an important drive to save the steppe biotope (5). Today, more than 120 Przewalski's horses live in Hustai and a further conservation programme run by the International Takhi Group (a consortium of European takhi breeding institutions) together with the Mongolian Commission for Endangered Species has introduced a further 50 horses to an area in the Dzungarian Gobi in Southwest Mongolia (6). The return of the Przewalski's horse to its natural environment is a success story for conservation and, despite ongoing problems, it is hoped that at least two large, self-sustained populations will soon be a reality (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Its meat has been hunted, but other than that, it has never been domesticated by man (Burton 1962).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Przewalski's horse

Przewalski's horse (Pronounced Sheh-VAL-ski; play /ʃɨˈvælski/ or /zɨˈvɑːlsk/; Polish: [pʂɛˈvalski]; Equus ferus przewalskii, Mongolian: Тахь, Takhi)[2] or Dzungarian horse, is a rare and endangered subspecies of wild horse (Equus ferus) native to the steppes of central Asia, specifically China and Mongolia.[3] At one time extinct in the wild, it has been reintroduced to its native habitat in Mongolia at the Khustain Nuruu National Park, Takhin Tal Nature Reserve and Khomiin Tal.[1] The taxonomic position is still debated, and some taxonomists treat Przewalski's horse as a species, Equus przewalskii. In China, the last wild Przewalski's horses were seen in 1966. The Przewalski's Horse Reintroduction Project of China was initiated in 1985 with the creation of the Xinjiang Wild Horse Breeding Center.

Common names for this equine include Asian wild horse, Przewalski's Wild Horse,Mongolian wild horse and the Tahki. Historical but obsolete names include true tarpan[4] and Mongolian tarpan. The horse is named after the Russian geographer and explorer Nikolai Przhevalsky.

Most "wild" horses today, such as the American Mustang or the Australian Brumby, are actually feral horses descended from domesticated animals that escaped and adapted to life in the wild. In contrast, Przewalski's horse has never been successfully domesticated and remains a truly wild animal today. Przewalski's horse is one of three known subspecies of Equus ferus, the others being the domesticated horse, Equus caballus and the extinct tarpan (Equus ferus ferus). The Przewalski's horse is considered the only remaining truly wild "horse" in the world and may be the closest living wild relative of the domesticated horse. There are still a number of other wild equines, including three species of zebra and various subspecies of the African wild ass, onager (including the Mongolian wild ass) and kiang.

Contents

Taxonomy

The Przewalski's horse was described in 1881 by L.S. Poliakov. The taxonomic position of Przewalski's horse has always been problematic and no consensus exists whether it is a full species (Equus przewalskii), a subspecies of the wild horse (Equus ferus przewalskii) or even a sub-population of the horse (Equus ferus).[5][6][7] Studies using DNA have been inconclusive, in part due to crossing domestic horses into the Przewalski's horse as well as the limited genetic variation present in the founder population of the Przewalski's horse. A 2009 molecular study using ancient DNA (that is DNA recovered from archaeological finds like bones and teeth) places the Przewalski's horse in the middle of the domesticated horses,[7] but more recent mitochondrial DNA analysis suggests that the Przewalski and the modern domestic horse diverged some 160,000 years ago.[8] The karyotype of the domestic horse differs from that of Przewalski’s horse by an extra chromosome pair either because of the fission of domestic horse chromosome 5 in Przewalski’s horse or fusion of Przewalski’s horse chromosomes 23 and 24 in the domestic horse. In comparison, the chromosomal differences between domestic horses and zebras include numerous translocations, fusions, and inversions. Przewalski’s horse is known to have the highest diploid chromosome number among all equine species. Przewalski’s horse can interbreed with the domestic horse and produce fertile offspring (65 chrosomes) [9]

Population

The world population of these horses are all descended from 9 of the 31 horses in captivity in 1945.[10] These nine horses were mostly descended from approximately 15 captured around 1900. A cooperative venture between the Zoological Society of London and Mongolian scientists has resulted in successful reintroduction of these horses from zoos into their natural habitat in Mongolia; and as of 2011 there is an estimated free-ranging population of over 300 in the wild.[11] The total number of these horses according to a 2005 census was about 1,500.[12]

Appearance

Przewalski's horse is stockily built in comparison to domesticated horses, with shorter legs. Typical height is about 13 hands (52 inches, 132 cm), length is about 2.1 m (6 ft 11 in). They weigh around 300 kilograms (660 lb). The coat is generally dun in color with pangaré features, varying from dark brown around the mane (which stands erect) to pale brown on the flanks and yellowish-white on the belly and around the muzzle. The legs of Przewalski's horse are often faintly striped, also typical of primitive markings.[13] The tail is about 90 cm (35.43 in) long, with a longer dock and shorter hair than seen in domesticated horses.

Behavior

Przewalski's horses

In the wild, Przewalski's horses live in social groups consisting of a dominant stallion, a dominant lead mare, other mares, and their offspring. The patterns of their daily lives exhibit horse behavior similar to that of feral horse herds. Each group has a well-defined home range; within the range, the herd travels between 3 miles (4.8 km) and 6 miles (9.7 km) a day, spending time grazing, drinking, using salt licks and dozing. At night, the herd clusters and sleeps for about four hours. Ranges of different herds may overlap without conflict, as the stallions are more protective of their mares than their territory.

Stallions practice a form of scent marking and will establish piles of dung at intervals along routes they normally travel to warn other males of their presence. In addition, when a female in the herd urinates, the stallion will frequently urinate in the same place, to signal her membership in the herd to other males. The stallions can frequently be seen sniffing dung piles to confirm scent markings.[citation needed]

History

In the 15th century, Johann Schiltberger recorded one of the first European sightings of the horses in the journal of his trip to Mongolia as a prisoner of the Mongol Khan.[14] The horse is named after the Russian colonel Nikolai Przhevalsky (1839–1888) (the name is of Polish origin and "Przewalski" is the Polish spelling). He was the explorer and naturalist who first described the horse in 1881, after having gone on an expedition to find it, based on rumors of its existence. Many of these horses were captured around 1900 by Carl Hagenbeck and placed in zoos. As noted above, about twelve to fifteen reproduced and formed today's population.

Head shot, showing convex profile

The native population declined in the 20th century due to a combination of factors, with the wild population in Mongolia dying out in the 1960s. The last herd was sighted in 1967 and the last individual horse in 1969. Expeditions after this failed to locate any horses, and the species was designated "extinct in the wild" for over 30 years.

After 1945 only two captive populations in zoos remained, in Munich and in Prague. The most valuable group, in Askania Nova, Ukraine, was shot by German soldiers during World War II occupation, and the group in the USA had died out.

By the end of the 1950s, only 12 individual Przewalski's horses were left in the world.[15]

Przewalski's horses

In 1977, the Foundation for the Preservation and Protection of the Przewalski horse was founded in Rotterdam, the Netherlands, by Jan and Inge Bouman. The Foundation started a program of exchange between captive populations in zoos throughout the world to reduce inbreeding, and later began a breeding program of its own. As a result of such efforts, the extant herd has retained a far greater genetic diversity than its genetic bottleneck made likely.[15]

In 1992, sixteen horses were released into the wild in Mongolia, followed by additional animals later on. One of the areas to which they were reintroduced became Khustain Nuruu National Park in 1998. Another reintroduction site is Great Gobi B Strictly Protected Area, located at the fringes of the Gobi desert.

The reintroduced horses successfully reproduced, and the status of the animal was changed from "extinct in the wild" to "endangered" in 2005.[12] On the IUCN Red List, they were reclassified from "extinct in the wild" to "critically endangered" after a reassessment in 2008[16] and from "critically endangered" to "endangered" after a 2011 reassessment.[11]

Preservation efforts

Close up image

While dozens of zoos worldwide have Przewalski's horses in small numbers, there are also specialized reserves dedicated primarily to the species.

The world's largest captive breeding program for Przewalski's horses is at the Askania Nova preserve in Ukraine. Several dozen Przewalski's horses were also released in the area evacuated after the Chernobyl accident, which now serves as a deserted de facto natural preserve.[17] An intensely researched population of free-ranging animals was also introduced to the Hortobágy puszta in Hungary; data on social structure, behavior, and diseases gathered from these animals is used to improve the Mongolian conservation effort.

Several American zoos also collaborated in breeding Equus ferus przewalskii from 1979 to 1982.[18] Recent advances in equine reproductive science in the USA also have potential to further preserve and expand the gene pool. In October 2007, scientists at the Smithsonian Institution's National Zoo successfully reversed a vasectomy on a Przewalski's horse — the first operation of its kind on this species and possibly the first ever on any endangered species. While normally a vasectomy may be performed on an endangered animal under limited circumstances, particularly if an individual has already produced many offspring and its genes are overrepresented in the population, scientists realized the animal in question was one of the most genetically valuable Przewalski's horses in the North American breeding program.[19]

There is also a scheme to breed horses run by WWF, the Tour de Valat research station and the Cévennes National Park authority which is based at Le Villaret on the Causse Mejean in the Cévennes National Park, France known as TAKH. Eleven horses were introduced in 1993 into a remote fenced upland area, which formed themselves into family groups and bred, the population reaching 50 by 2003. In 2004 and 2005 horses from this group were sent to Mongolia. In 2011 there were 31 individuals left in France [20]

The Przewalski's Horse Reintroduction Project of China was initiated in 1985 when the country introduced 11 wild horses from overseas. After more than two decades of dedicated efforts, the Xinjiang Wild Horse Breeding Center managed to breed a large number of the horses, of which 55 were let loose into the Kalamely Mountain area. The animals quickly adapted to their new environment. In 1988, six foals were born and survived. In 2001 there were over 100 horses at the center. Now both their reproduction rate and survival rate are the highest in the world.[citation needed]

See also

Notes

  1. ^ a b Boyd, L. & King, S. R. B. (2011). "Equus ferus ssp. przewalskii". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/7961. Retrieved 18 January 2012. 
  2. ^ "The Takhi". International Takhi-Group. http://www.savethewildhorse.org/takhi.html. Retrieved October 25, 2010. 
  3. ^ Grubb, Peter (16 November 2005). "Order Perissodactyla (pp. 629-636)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 630-631. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14100018. 
  4. ^ William Ridgeway (1908). "Environment and race". The Geographical Journal (Royal Geographical Society.) 32 (4): 405–412. doi:10.2307/1776930. JSTOR 1776930. http://books.google.com/?id=MqgMAAAAIAAJ&pg=PA407&dq=tarpan. , page 407
  5. ^ lau, Allison; Lei Peng, Hiroki Goto, Leona Chemnick, Oliver A. Ryder, Kateryna D. Makova (2009). "Horse Domestication and Conservation Genetics of Przewalski’s Horse Inferred from Sex Chromosomal and Autosomal Sequences". Mol. Biol. Evol. 26 (1): 199–208. doi:10.1093/molbev/msn239. PMID 18931383. 
  6. ^ Kavar, Tatjana; Peter Dovč (2008). "Domestication of the horse: Genetic relationships between domestic and wild horses". Livestock Science 116: 1–14. doi:10.1016/j.livsci.2008.03.002. 
  7. ^ a b Cai, Dawei; Zhuowei Tang, Lu Han, Camilla F. Speller, Dongya Y. Yang, Xiaolin Ma, Jian’en Cao, Hong Zhu, Hui Zhou (2009). "Ancient DNA provides new insights into the origin of the Chinese domestic horse". Journal of Archaeological Science 36 (3): 835–842. doi:10.1016/j.jas.2008.11.006. 
  8. ^ O A Ryder, A R Fisher, B Schultz, S Kosakovsky Pond, A Nekrutenko, K D Makova. "A massively parallel sequencing approach uncovers ancient origins and high genetic variability of endangered Przewalski's horses". Genome Biology and Evolution. 2011
  9. ^ lau, Allison; Lei Peng, Hiroki Goto, Leona Chemnick, Oliver A. Ryder, Kateryna D. Makova (2009). "Horse Domestication and Conservation Genetics of Przewalski’s Horse Inferred from Sex Chromosomal and Autosomal Sequences". Mol. Biol. Evol. 26 (1): 199–208. doi:10.1093/molbev/msn239. PMID 18931383. 
  10. ^ Boyd, Lee. (1994). Przewalski's Horse, p. 1.
  11. ^ a b "Another leap towards the Barometer of Life". International Union for the Conservation of Nature. 10 November 2011. http://www.iucn.org/about/work/programmes/species/red_list/?8548/Another-leap-towards-the-Barometer-of-Life. 
  12. ^ a b "An extraordinary return from the brink of extinction for worlds last wild horse" ZSL Living Conservation, December 19, 2005.
  13. ^ National Zoo information on Przewalski's horse
  14. ^ Breeds of Livestock - Przewalski Horse
  15. ^ a b O. A. Ryder et al, ibid
  16. ^ IUCN Red List - Equus ferus
  17. ^ Mulvey, Stephen (April 20, 2006). "Wildlife defies Chernobyl radiation". BBC News. http://news.bbc.co.uk/2/hi/europe/4923342.stm. Retrieved October 3, 2007. 
  18. ^ Oliver A. Rydera and Elizabeth A. Wedemeyera, "A cooperative breeding programme for the Mongolian wild horse Equus przewalskii in the United States," Biological Conservation, Volume 22, Issue 4, April 1982, pp. 259-271, abstract found at Science Direct website. Accessed February 24, 2010.
  19. ^ "Zoo Performs First Reverse Vasectomy on Horse" The Horse online edition, citing Associated Press, June 17, 2008.
  20. ^ "Przewalski's Horse - the last wild horse" leaflet produced by TAKH, available on-line [1]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!