Overview

Brief Summary

The larval stage of the cestode (tapeworm) Echinococcus granulosus causes cystic echinococcosis, the form of human echinococcosis (hydatidosis, or hydatid disease) most frequently encountered. Echinococcus granulosus occurs practically worldwide and more frequently in rural, grazing areas where dogs ingest organs from infected animals.

The adult Echinococcus granulosus (3 to 6 mm long) resides in the small bowel of the definitive hosts, dogs or other canids. Gravid proglottids (bisexual reproductive segments) release eggs that are passed in the feces. After ingestion by a suitable intermediate host (under natural conditions: sheep, goat, swine, cattle, horses, camel), the egg hatches in the small bowel and releases an oncosphere that penetrates the intestinal wall and migrates through the circulatory system into various organs, especially the liver and lungs. In these organs, the oncosphere develops into a cyst that enlarges gradually, producing protoscolices and daughter cysts that fill the cyst interior. The definitive host becomes infected by ingesting the cyst-containing organs of the infected intermediate host. After ingestion, the protoscolices evaginate, attach to the intestinal mucosa, and develop into adult stages (7) in 32 to 80 days.

(Centers for Disease Control Parasites and Health website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

This species has a worldwide distribution, found in both domestic and wild settings. Humans are infected especially in countries with extensive pastoral activities. The highest frequencies of E. granulosus are found in Eurasia, Africa, Australia, and South America.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical ; australian

Other Geographic Terms: cosmopolitan

  • Arambulo, P. 1997. Public health importance of cystic echinococcus in Latin America. Acta Tropica, 67: 113-124.
  • Eckert, J., F. Conraths, K. Tackmann. 2000. Echinococcus: an emerging or re-emerging zoonosis. International Journal for Parasitology, 30: 1283-1294.
  • Lightowlers, M., A. Flisser, C. Gauci, D. Heath, O. Jensen. 2000. Vaccination against cysticercosis and hyatid disease. Parasitology Today, 16(5): 191-196.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The mature adult measures 3 to 9 mm long and consists of only 3 proglottids (the immature, mature and gravid), a scolex with four suckers, and a double crown of 28 to 50 hooks on the rostellum, at the tip of the scolex. Echinococcus granulosus may be found as a hydatid cyst in any organ of an intermediate host. The size of a cyst ranges from 4.1 to 7.2 cm and takes about 5 months to develop. Eggs of E. granulosus are indistinguishable from other taeniid eggs, typically 32-36 by 25-30 micrometers.

Range length: 3 to 9 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Kearn, G. 1998. Parasites and the Platyhelminthes. London: Chapman and Hall.
  • Wardle, R., J. McLeod, S. Radinovsky. 1974. Advances in the Zoology of Tapeworms, 1950 - 1970. London and Delhi: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Adult E. granulosus are found in the intestines of canines such as dogs, wolves or dingos. It can also be found in lions. Echinococcus granulosus larvae are found primarily in the lungs and liver, but may be found in any organ of the intermediate host. These hosts include sheep, moose, wallabies, camels, warthogs, and reindeer. Humans are most often infected with hydatid cysts in sheep-raising communitees. Accidental ingestion of E. granulosus eggs results from humans touching dogs that come in contact with livestock.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: tundra ; desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

  • Roberts, L., J. Janovy. 2000. Foundations of Parasitology Sixth Edition. New York: McGraw Hill.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The adult Echinococcus granulosus is parasitic on canids, the definitive hosts. Nutrients are absorbed across the worm's tegument. Many mammals may be intermediate hosts, especially herbivores.

Animal Foods: body fluids

Primary Diet: carnivore (Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / parasite / endoparasite
multiple tapeworm of Echinococcus granulosus endoparasitises ilium of Canis familiaris
Other: major host/prey

Animal / parasite / endoparasite
multiple tapeworm of Echinococcus granulosus endoparasitises ilium of Felis domesticus
Other: unusual host/prey

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Homo sapiens

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Equus caballus

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Ovis aries

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Bos taurus (domestic)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Echinococcus granulosus parasitizes canines such as dogs, wolves or dingos. It can also be found in lions. Intermediate hosts include sheep, moose, wallabies, camels, warthogs, and reindeer.

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

These animals are probably not preyed on directly but are ingested. Egg and larval mortality are high due to the parasite not reaching appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cestodes in general have sensory organs in the scolex, which are attached to longitudinal nerves extending down the body. The nerves are attached to organs and the cestodes can detect tactile stimulation.

Communication Channels: tactile

Perception Channels: tactile

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

The gravid proglottid detaches from the adult and ruptures, releasing eggs into the feces of the definitive host. The intermediate host ingests eggs in contaminated food or water. The egg hatches to an oncosphere which develops into a unilocular hyatid cyst. Daughter cysts bud from the inner walls of the cyst via asexual reproduction, giving rise to numerous juveniles called protoscolices. Canids eat the intermediate host and hence acquire the protoscolices which develop to adults.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The gravid proglottid detaches from the adult and ruptures, thereby releasing eggs into the feces of the definitive host. The intermediate host ingests eggs in contaminated food or water. The egg hatches to an oncosphere which develops into a unilocular hyatid cyst. Daughter cysts bud from the inner walls of the cyst via asexual reproduction, giving rise to numerous juveniles called protoscolices. Canids eat the intermediate host and hence acquire the protoscolices which develop to adults.

Key Reproductive Features: simultaneous hermaphrodite; sexual ; asexual

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echinococcus granulosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 80 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAGAGTGGTGTGATTAGGTAGATGGGTGTTTACTTTAGATCATAAGCGCATAGGTGTGATTTATAGTTTATTGGGTATATGATCTGGTTTTGTGGGTTTGAGATTTAGTTTGTTGATTCGTGTTAATTTTTTGGAGCCTTATTATAATGTTATACCTTTGGATTGTTATAATTTTTTGGTTACAAACCATGGTATAATAATGATTTTTTTTTTCTTGATGCCTATATTGATTGGGGGGTTTGGGAATTATTTATTGCCTTTGTTAGGTGGGTTGTCTGATTTGAATTTACCGCGTTTGAATGCTTTGAGTGCTTGACTTTTGATTCCTTCGTTGGTTTTTTTGTTGGTTAGTATGTGTTTAGGGGCTGGTGTTGGTTGGACATTTTATCCGCCGTTGTCCTCGTCGTATTTTTCTAGTAGTTGTGGTGTTGATTTTTTGATGTTTTCTCTGCATTTGGCTGGTGTTTCAAGTGTTTTTAGTTCTATTAAATTTATTTGTACTCTATATAGGGTTTTTATGACCAAAGTGTTTTCTCGTACTTCTATAGTTCTTTGGTCATATTTATTTACTTCTGTTTTGTTATTGGTTACGTTGCCTGTTTTGGCTGCGGCTATTACTATGCTTTTATTCGATCGTAATTTTTGTTCTGCTTTTTTTGATCCGTTAGGTGGTGGTGATCCTATTTTATTTCAACATATGTTTTGGTTTTTTGGCCATCCTGAGGTTTATGTGTTGATTTTGCCTGGATTTGGTATAATTAGTCATATTTGTTTGAGTATTAGTGCTAATTTTGATGCGTTTGGGTTCTATGGGTTGTTGTTTGCTATGTTTTCTATAGTGTGTTTGGGTAGTAGGGTTTGGGGTCATCATATGTTTACTGTTGGGTTGGATGTGAAGACGGCTGTTTTTTTTAGCTCTGTTACTATGATTATAGGGGTTCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGTTGTTGAATTCGAGTGTTAATGTTAGTGATCCGGTTTTGTGATGGGTTGTTTCTTTTATAGTGTTGTTTACGTTTGGGGGAGTTACGGGTATAGTTTTGTCTGCTTGTGTGTTAGATAATATTTTGCATGATACTTGGTTTGTGGTGGCTCATTTTCATTATGTTATGTCGTTAGGTTCTTATATAAGGATTATTGTTATGTTTATTTGGTGATGGCCTTTGATTACTGGTTTGAGATTGAATAAGTGTTTATTGCAATGTCAGTGTATTATCTCTAATGTTGGGTTTAATCTTTGTTTTTTTCCTATGCATTATTTTGGTTTGTGTGGTTTGCCGCGTCGTGTGTGCATTTATGAATATAGGTATAATTGGATAAATGTGGTGTGTACTGTTGGTTCTTTTATATCTGCTTTTAGTGGATGTTTTTTTGTGTTTATTTTGTGGGAGTCTATTGTTAGTAAGAATGAGGTTTTGGGTTCGTATAAATCTTCTGGTTTAGTGGATTGTTTGATGAGTCCTGTAGCTTGTCATAATGATTATTTTTGTTATCCGTATAGCGTGGATTATACTTATGGTGTGTATTATATGCGTTGGGTTGATGATTGTACGTATGCGTTTGTGGTTGGTTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Echinococcus granulosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 85
Specimens with Barcodes: 85
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In humans, Echinococcus granulosus is the most common agent of cystic hyatid disease. Cysts may be asymptomatic for years, but pressure of the cyst on surrounding tissues or bones may lead to blindness, collapse of infected bones, or even sudden death if the cyst is in the heart. If a cyst ruptures the host may get anaphylactic shock, a hypersensitive reaction to a flood of foreign material in the body that results in death. Treatment for this disease often involves removal of the cyst via major surgery. (Lightowlers et al, 2000)

Negative Impacts: injures humans (causes disease in humans ); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Echinococcus granulosus

This article is about the tapeworm. For the infection, see echinococcosis.

Echinococcus granulosus, also called the Hydatid worm or Hyper Tape-worm or Dog Tapeworm, is a cyclophyllid cestode that parasitizes the small intestine of canids as an adult, but which has important intermediate hosts such as livestock and humans, where it causes cystic echinococcosis, also known as hydatid disease. The adult tapeworm ranges in length from 2 mm to 7 mm and has three proglottids ("segments") when intact — an immature proglottid, mature proglottid and a gravid proglottid. Like all cyclophyllideans, E. granulosus has four suckers on its scolex ("head"), and E. granulosus also has a rostellum with hooks. Several strains of E. granulosus have been identified, and all but two are noted to be infective in humans.[1]

The lifecycle of E. granulosus involves dogs and wild carnivores as a definitive host for the adult tapeworm.[2] Definitive hosts are where parasites reach maturity and reproduce. Wild or domesticated ungulates, such as sheep, serve as an intermediate host.[2] Transitions between life stages occur in intermediate hosts. The larval stage results in the formation of echinococcal cysts in intermediate hosts.[2] Echinococcal cysts are slow growing,[2] but can cause clinical symptoms in humans and be life-threatening.[3] Cysts may not initially cause symptoms, in some cases for many years.[2] Symptoms developed depend on location of the cyst, but most occur in the liver, lungs, or both.[3]

E. granulosus was first document in Alaska but is distributed world-wide. It is especially prevalent in parts of Eurasia, north and east Africa, Australia, and South America.[3] Communities that practice sheep farming experience the highest risk to humans,[3] but wild animals can also serve as an avenue for transmission. For example, dingoes serve as a definitive host before larvae infect sheep in the mainland of Australia.[3] Sled dogs may expose moose or reindeer to E. granulosus in parts of North America and Eurasia.[3]

Transmission[edit]

E. granulosus life cycle

E. granulosus requires two host types, a definitive host and an intermediate host. The definitive host of this parasite are dogs and the intermediate host are most commonly sheep, however, cattle, horses, pigs, goats, and camels are also potential intermediate hosts.[4] Humans can also be an intermediate host for E. granulosus, however this is uncommon and therefore humans are considered an aberrant intermediate host.[4]

E. granulosus is ingested and attaches to the mucosa of the intestines in the definitive host and there the parasite will grow into the adult stages.[5] Adult E. granulosus release eggs within the intestine which will be transported out of the body via feces.[5] When contaminated waste is excreted into the environment, intermediate host has the potential to contract the parasite by grazing in contaminated pasture, perpetuating the cycle.[4][6]

E. granulosus is transmitted from the intermediate host (sheep) to the definitive host (dogs) by frequent feeding of offal, also referred to as “variety meat” or “organ meat”. Consuming offal containing E. granulosus can lead to infection; however, infection is dependent on many factors.[3]

The frequency of offal feedings, the prevalence of the parasites within the offal, and the age of the intermediate host are factors that affect infection pressure within the definitive host.[5] The immunity of both the definitive and intermediate host plays a large role in the transmission of the parasite, as well as the contact rate between the intermediate and the definitive host (such as herding dogs and pasture animals being kept in close proximity where dogs can contaminate grazing areas with fecal matter).[3]

The life expectancy of the parasite, coupled with the frequency of anthelminthic treatments, will also play a role in the rate of infection within a host. The temperature and humidity of the environment can affect the survival of E. granulosus.[3]

Once sheep are infected, the infection typically remains within the sheep for life. However in other hosts, such as dogs, treatment for annihilating the parasite is possible. However, the intermediate host is assumed to retain a greater life expectancy than the definitive host.[3][6]

Diagnosis[edit]

Diagnosis in the definitive host, the dog, is difficult by ordinary microscopy as it cannot differentiate between Taenia and Echinococcus eggs. Detection of antigens in feces by ELISA is currently the best available technique. The prevalence of Echinococcus granulosus was found to be 4.5% in Bangalore, India by a study conducted by Centre of Advanced Studies in Veterinary Parasitology, Veterinary College, Hebbal, Bangalore employing this coproantigen detection technique. Newer techniques like PCR is also used to identify the parasite from DNA isolated from eggs or feces.

Risk in Humans[edit]

Humans should avoid handling fecal matter of canines and avoid consuming infected animals and home slaughtering animals. If a human, becomes infected, there are a variety of methods for treatment.[1][7] The most common treatment in the past years has been surgical removal of the hydatid cysts.[7] However in recent years, less invasive treatments have been developed such as cyst puncture, aspiration of the liquids, the injection of chemicals, and then re-aspiration.[1] Benzimidazole-based chemotherapy is also a new treatment option for humans.[1]

Prevention[edit]

In order to prevent transmission to dogs from intermediate hosts, dogs can be given anthelminthic vaccinations.[7][2] In the case of intermediate hosts, especially sheep, these anthelminthic vaccinations do cause an antigenic response—meaning the body produces antibodi avinash response—however it does not prevent infection in the host.[7][2]

Clean slaughter and high surveillance of potential intermediate host during slaughter is key in preventing the spread this cestode to its definitive host. It is vital to keep dogs and potential intermediate host as separated as possible to avoid perpetuating infection.[2]

According to mathematical modeling, vaccination of intermediate hosts, coupled with dosing definitive hosts with anthelminths is the most effect method for intervening with infection rates.[2]

See also[edit]

References[edit]

  1. ^ a b c d Eckert J, Deplazes P (January 2004). "Biological, epidemiological, and clinical aspects of echinococcosis, a zoonosis of increasing concern". Clin. Microbiol. Rev. 17 (1): 107–35. PMC 321468. PMID 14726458. 
  2. ^ a b c d e f g h i Moro P, Schantz PM (March 2009). "Echinococcosis: a review". Int. J. Infect. Dis. 13 (2): 125–33. doi:10.1016/j.ijid.2008.03.037. PMID 18938096. 
  3. ^ a b c d e f g h i j McManus DP, Zhang W, Li J, Bartley PB (October 2003). "Echinococcosis". Lancet 362 (9392): 1295–304. doi:10.1016/S0140-6736(03)14573-4. PMID 14575976. 
  4. ^ a b c Torgerson PR, Heath DD (2003). "Transmission dynamics and control options for Echinococcus granulosus". Parasitology 127 (Suppl): S143–58. PMID 15027611. 
  5. ^ a b c Moro PL, McDonald J, Gilman RH, et al. (1997). "Epidemiology of Echinococcus granulosus infection in the central Peruvian Andes". Bull. World Health Organ. 75 (6): 553–61. PMC 2487032. PMID 9509628. 
  6. ^ a b Lahmar S, Debbek H, Zhang LH, et al. (May 2004). "Transmission dynamics of the Echinococcus granulosus sheep-dog strain (G1 genotype) in camels in Tunisia". Vet. Parasitol. 121 (1-2): 151–6. doi:10.1016/j.vetpar.2004.02.016. PMID 15110412. 
  7. ^ a b c d Craig PS, McManus DP, Lightowlers MW, et al. (June 2007). "Prevention and control of cystic echinococcosis". Lancet Infect Dis 7 (6): 385–94. doi:10.1016/S1473-3099(07)70134-2. PMID 17521591. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!