Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

Range Description

This species occurs through most of the United States, and ranges into southern Canada and northern and eastern Mexico, discontinuously southward to Guatemala and Belize. It extends from southern British Columbia, southern Saskatchewan, Wisconsin, Michigan, southern Ontario, New York, and southern Maine southward in the United States to southern California, Arizona, New Mexico, Texas, the Gulf Coast, and southern Florida, and southward through northeastern, central, and southern Mexico to Guatemala and Belize (Wilson 1978, Campbell 1998, Lee 2000, Stafford and Meyer 2000, Ernst and Ernst 2003, Stebbins 2003). Elevational range extends from sea level to about 2,550 meters (8,300 feet). A record for Durango, Mexico, evidently is erroneous (Webb 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Racers are found from southern Canada to Guatemala and almost everywhere in between. These snakes can be found in every state of the U.S, including Michigan's southern lower peninsula.

Biogeographic Regions: nearctic (Native )

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians: Peterson Field Guides. 3rd Ed.. New York: Houghton Mifflin Company.
  • Ernst, C., R. Barbour. 1998. Snakes of Eastern North America. Virginia: George Mason University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Racers occur from southern Canada to Guatemala, with considerable individual and local variation in regions where two or more subspecies intergrade (Conant and Collins, 1998). Different racer subpopulations include: The northern black racer, Coluber constrictor constrictor, ranges from southern Maine and central New York south to northern Georgia and Alabama. The blue racer, C. c. foxii, is found from Michigan, Wisconson, and Minnesota south to Ohio, Indiana, and Illinois. C. c. priapus, the southern black racer, ranges from southern Indiana and Illinois and southeastern North Carolina to central Florida and southern Arkansas. It also occurs on some of the Florida Keys. The Everglades Racer, C. c. paludicola, is found only in southern Florida. The brownchin racer, C. c. helvigularis, occurs only in the lower Chipola and Appalachicola River valleys in Georgia and Florida. C. c. latrunculus, the blackmask racer, occurs in southeastern Louisiana and adjacent Mississippi. The eastern yellow-bellied racer, C. c. flaviventris, is found from extreme southern Saskatchewan southeast through Montana, western North Dakota, east to Iowa and south to Texas. The western yellow-bellied racer is found west of the Rocky Mountains, from southern California and Nevada through through western Colorado, Oregon, and Washington and into southern British Columbia. The buttermilk racer, C. c. anthicus, ranges from south Arkansas to Louisiana, also eastern Texas. C. c. etheridgei, the tan racer inhabits Louisiana and Texas. C. c. oaxaca, the Mexican racer, has isolated populations in New Mexico, but its main range is from south Texas to Veracruz.

Biogeographic Regions: nearctic (Native )

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians: Peterson Field Guides. 3rd Ed.. New York: Houghton Mifflin Company.
  • Ernst, C., R. Barbour. 1998. Snakes of Eastern North America. Virginia: George Mason University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The range extends from southern British Columbia, southern Saskatchewan, Wisconsin, Michigan, southern Ontario, New York, and southern Maine southward in the United States to southern California, Arizona, New Mexico, Texas, the Gulf Coast, and southern Florida, and southward through northeastern, central, and southern Mexico to Guatemala and Belize (Wilson 1978, Lee 2000, Ernst and Ernst 2003, Stebbins 2003). A record for Durango, Mexico, evidently is erroneous (Webb 2001). Elevational range extends from sea level to about 2,550 meters (8,300 feet).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America North-America
Distribution: S Canada (incl. Saskatchewan) USA (Washington, Oregon, California, Illinois, New Mexico, Texas, Oklahoma, Kansas, Nebraska, Minnesota, Colorado, Wyoming, Montana, South Dakota, Idaho, Utah, Iowa, Missouri, Arkansas, Louisiana, Mississippi, Alabama, Georgia, Florida, South Carolina, North Carolina, Virginia, West Virginia, Kentucky, Indiana, Illinois, Wisconsin, Ohio, Maryland, Pennsylvania, New Jersey, New York, Rhode Island, Connecticut, Massachusetts, S New Hampshire, S Vermont, S Maine; Tennessee [latrunculus: HR 31: 54]) E/SE Mexico (Yucatan, Durango), Belize, N Guatemala  constrictor: S Maine to NE Alabama.  anthicus: S Arkansas, Louisiana, E texas.  etheridgei: WC Louisiana, adjacent Texas.  flaviventris: Montana, W North Dakota, east to Iowa and south to Texas, SW Louisiana; Arkansas, Colorado, Kansas, Missouri, Michigan, Wisconsin, Oklahoma; isolated populations in New Mexico and Texas.  foxii: S Ontario, NW Ohio to E Iowa and SE Minnesota; Wisconsin; an isolated population in Menominee Co., Michigan (intergrades with flaviventris).  helvigularis: Lower Chipola and Apalachicola R. valleys in Florida panhandle and adjacent Georgia.  latrunculus: SE Louisiana north along the east side of the Mississippi to N Missouri.  oaxacae: S Texas and Tamaulipas to C Veracruz; isolated records in Nuevo León, Coahuila, Durango, Colima, Oaxaca, Chiapas, and Guatemala.
Type locality: “Mexico”. Seems to intergrade with flaviventris in New Mexico and Texas. Holotype: MNHN.  paludicola: Everlglades, SE Florida, upper Florida Keys, E Florida. Holotype: USNM  priapus: SE states and north and west in Mississippi valley to S Indiana and SE Oklahoma, Lower Florida Keys.  
Type locality: “Canada”
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Coluber_constrictor is a long, slender snake, which can reach lengths of 6 feet (191 cm). They range in color from blue in the north to black in the south and yellow and gray in the western U.S. The blue and black racers have no skin patterns, but some other racers have spots or blotches. Racers in Michigan are a dark-blue color and have white chins.

Young racers have a gray body covered with brown or red bands.

Range length: 191 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The mature racer has very smooth shiny scales with a divided anal plate (Conant and Collins, 1998). There are 17 scale rows midbody, and 15 near the tail. The normal coloration is a very dark and uniform dorsum with variations ranging from black, bluish, gray, to olive brown. The head is narrow but still wider than the neck with very distinct brow ridges. The chin and throat areas vary from white to yellowish progressing back to a ventrum that could be black, dark gray, light blue, white, cream or yellow. The average adult length ranges from 90-190 cm. (35-75 in.) (Harding, 1997).

Juvenile racers are strongly patterned with grays, browns, and reds. The coloring fades as the snake grows older and at 30 inches all traces have usually disappeared (Conant and Collins, 1998).

Male racers can be distinguished from the female of the species in that the tail is longer with a wide base, sometimes even a bulge. The female's tail tapers abruptly from the body (Harding, 1997).

Range length: 191 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 196 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitats encompass a wide range of lowland and montane areas, including deserts, prairies, sandhills, shrublands, woodlands, forests, canyons, streamsides, and semi-agricultural areas. These snakes are absent from the driest deserts and highest mountains (subalpine zones and higher). They commonly climb shrubs and small trees. When inactive, they hide underground, in crevices, or under surface cover. Adults often hibernate communally, sometimes partly submerged in water. Eggs are laid in underground tunnels or burrows, rotting stumps, sawdust piles, or under rocks. Oviposition sites may be up to at least several hundred meters from the usual home range (Brown and Parker 1976, Iverson et al. 1995).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Racers live in dry, sunny areas such as old farm fields, grass meadows, thin forests, and swamps. During the coldest winter months, racers hibernate in underground shelters.

Habitat Regions: temperate

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Wetlands: marsh ; swamp ; bog

Other Habitat Features: agricultural

  • Harding, J. 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, MI: University of Michigan Press.
  • Greene, H. 1997. Snakes: The Evolution of Mystery in Nature. California: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Racers prefer dry sunny areas with access to cover, including old fields, open woodland, hedgerows, thickets and wood edges, sometimes damper sites such as bogs, marshes, and lake edges are also used. In the Great Lakes region, racers occupy a home area that may range in size from 2.5 acres (1 ha) to 25 acres (20 ha) depending on the productivity of the habitat (Harding, 1997). During several cold months of the year racers are inactive in shelters hidden from subfreezing temperatures. Fall and spring activity peaks are associated with movement to and from the hibernacula as well as mating and feeding (Greene, 1997).

Habitat Regions: temperate

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Wetlands: marsh ; swamp ; bog

Other Habitat Features: agricultural

  • Harding, J. 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor, MI: University of Michigan Press.
  • Greene, H. 1997. Snakes: The Evolution of Mystery in Nature. California: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitats encompass a wide range of lowland and montane areas, including deserts, prairies, sandhills, shrublands, woodlands, forests, canyons, streamsides, and semi-agricultural areas. This snake is absent from the driest deserts and highest mountains (subalpine zones and higher). It commonly climbs shrubs and small trees. When inactive, it hides underground, in crevices, or under surface cover. Adults often hibernate communally, sometimes partly submerged in water. Eggs are laid in underground tunnels or burrows, rotting stumps, sawdust piles, or under rocks. Oviposition sites may be up to at least several hundred meters from the usual home range (Brown and Parker 1976, Iverson et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates up to at least 1.8 km between winter hibernaculum and summer range in Utah (Brown and Parker 1976), up to at least 2.3 km (average at least 848 m) in Michigan (Rosen 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Racers are carnivores. They have very broad diets. Juvenile racers eat mainly Insecta, Araneae, small Anura, small reptiles (including Sauria and Serpentes and their eggs) and young Rodentia and Soricidae. As racers grow, they take larger prey as well, including nestling Aves and their eggs, other Mammalia as large as Sciuridae and small Sylvilagus, small Testudines and larger snakes.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; insects; terrestrial non-insect arthropods

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Racers are carnivores. They have very broad diets. Juvenile racers eat mainly insects, spiders, small frogs, small reptiles (including lizards and snakes and their eggs) and young rodents and shrews. As racers grow, they take larger prey as well, including nestling birds and their eggs, other mammals as large as squirrels and small cottontail rabbits, small turtles and larger snakes (Greene, 1997). Their food is not constricted as the name would imply, instead a loop of the snake's body is thrown over the struggling victim, pressing it down so that it can be swallowed (Conant and Collins, 1998).

Animal Foods: birds; mammals; amphibians; reptiles; eggs; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet typically includes small mammals, birds, reptiles, amphibians, and large insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Coluber_constrictor is a mid-level predator, eating many kinds of smaller animals, but in turn eaten by larger predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Racers are eaten by Aves, Canis lupus familiaris, Felis silvestris, and Canis latrans.

Known Predators:

  • domestic dogs (Canis_lupus_familiaris)
  • domestic cats (Felis_silvestris)
  • coyotes (Canis_latrans)
  • birds (Aves)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Coluber constrictor is a mid-level predator, eating many kinds of smaller animals, but in turn eaten by larger predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Racers are eaten by birds, dogs, cats, and coyotes.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Coluber constrictor preys on:
Diadophis punctatus
Dendroica petechia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences or subpopulations (at least several hundred).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but probably exceeds 1,000,000. This snake is common in most of its very large range in the United States but appears to be rare at the southern extent of the range in southern Mexico, Guatemala, and Belize (Lee 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range size was estimated at 1.4 ha for nongravid females in Utah (Brown and Parker 1976), about 10 ha in Kansas (Collins 1982). In South Carolina, summer home range was 5-21 ha (mean 12 ha); movement on active days was 74-135 m (mean 104 m); home ranges overlapped (Plummer and Congdon 1994). Population density was estimated to be 0.65/ha in Utah (Brown 1973), up to about 15/ha in Kansas. Estimated adult annual survivorship was 79% in Utah, 62% in Kansas, 54% in Michigan (Rosen 1991).

When confronted by a person, racers, like many harmless snakes, sometimes vibrate the tail. In dry vegetation, this may produce a sound similar to that make by a rattlesnakes rattle.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As with many snakes, vision and olfaction are important percptual channels for racers.

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

As with many snakes, vision and olfaction are important percptual channels for racers.

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Racers are inactive during cold weather and are dormant from October or November to March or April in much of the range (Hammerson 1999). They are active on bright overcast or sunny days in summer, but typically only on sunny, relatively warm days in spring and fall (Hammerson, 1987, Rosen 1991). In South Carolina in summer, racers were active on an average of 72% of days; inactive snakes usually were in ecdysis (Plummer and Congdon 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, racers have been known to live over 10 years.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: captivity:
10 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

In the wild, racers have been known to live over 10 years.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: captivity:
10 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Racers mate in the spring and lay 3-32 oval-shaped eggs in early summer underneath tree stumps or in animal burrows. Sometimes, the eggs are found grouped with the eggs of other snake species.

Breeding interval: Mating takes place in the spring, from late April until early June.

Breeding season: June to early July

Range number of offspring: 3 to 32.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians: Peterson Field Guides. 3rd Ed.. New York: Houghton Mifflin Company.
  • Greene, H. 1997. Snakes: The Evolution of Mystery in Nature. California: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating takes place in the spring, from late April until early June. In June or early July the female will lay 3-32 oval, white eggs in a hidden nest site. Suitable nest sites may be a rotted stump or log, and old mammal burrow, or a nest cavity in the leaf litter or sand (Harding, 1997). The eggs are 2.5 to 3.9 cm long and are coated with small nodules resembling hard, dry grains of salt. Hatching usually occurs in August or early September with young size approximately 7.5-14 inches (39 cm) long (Conant and Collins, 1998). Males become sexually mature in 1 to 2 years, while females mature slower, approximately 2 to 3 years. Racers have been known to oviposit communally, one case reported shows that almost 300 eggs were found in a talus slide. They originated from at least 50 racers, sharp-tailed snakes (Contia tenuis), ring-necked snakes (Diadophis punctatus), and gopher snakes (Pituophis catenifer) (Greene,1997).

Breeding interval: Mating takes place in the spring, from late April until early June.

Breeding season: June to early July

Range number of offspring: 3 to 32.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians: Peterson Field Guides. 3rd Ed.. New York: Houghton Mifflin Company.
  • Greene, H. 1997. Snakes: The Evolution of Mystery in Nature. California: University of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs laying occurs in June or early to mid-July in most areas. Eggs laying peaks early to mid-June in southern Michigan (Rosen 1991), late June or early July in Utah/Colorado. Clutch size is usually 5-28, averages higher in the east than in the west; mean clutch size about 6 in Utah, 12 in Kansas, 15 in Michigan (Rosen 1991). Eggs hatch in about 6-9 weeks, generally in August or early September. Females become sexually mature in 3 years in Utah, 2-3 years in Kansas, 2 years in Michigan (Rosen 1991). Sometimes this snake nests communally.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coluber constrictor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCGGCACAGGATGAACCGTTTACCCCCCCCTATCAGGAAATTTAGTCCACTCTGGACCATCAGTAGACCTAGCAATTTTCTCGCTACACCTAGCAGGCGCTTCGTCCATCCTGGGAGCAATCAACTTCATTACAACATGCATCAACATAAAACCAAAATCCATACCAATATTCAATATCCCACTATTCGTCTGATCTGTACTAATTACCGCCATTATACTTCTACTAGCCCTACCAGTACTAGCAGCAGCAATTACAATACTATTAACAGACCGAAATATTAACACCTCATTCTTCGACCCCTGTGGAGGAGGGGACCCCGTACTATTTCAACACCTATTCTGATTCTTTGGTCACCCAGAAGTATATATCCTAATCCTACCAGGATTTGGTATCGTGTCAAGTATTATCACATTCTATACAGGAAAAAAGAACACATTTGGATACACAAGCATAATCTGAGCAATAATATCTATTGCTATCCTTGGGTTCGTTGTATGAGCCCACCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coluber constrictor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Hammerson, G.A., Acevedo, M., Ariano-Sánchez, D. & Johnson, J.

Reviewer/s
Bowles, P.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2007
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is still abundant in some places. A few states (Maine and Louisiana) and the Canadian province of Ontario give it some legal protection because it is rare there. It is becoming more uncommon in Michigan.

Chemical pesticides harm young racers. All racers have problems when their habitat is destroyed to build farms, houses, and other buildings. Then they have few places to hide, little to eat, and people who find them often kill them, even though they are harmless.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is still abundant in some places. A few states (Maine and Louisiana) and the Canadian province of Ontario give it legal protection because it is rare there.

Pesticide residue poses a danger to insectivorous young racers. The dangers faced by adults include their habitat reduction because of agriculture and suburban/urban development along with direct killing of snakes by people (Harding, 1997).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a very large number of occurrences or subpopulations (at least several hundred). The total adult population size is unknown but probably exceeds 1,000,000. This snake is common in most of its very large range in the United States but appears to be rare at the southern extent of the range in southern Mexico, Guatemala, and Belize (Campbell 1998, Lee 2000). The extent of occurrence, area of occupancy, number of subpopulations, and population size are very large and probably relatively stable. The southern subpopulations in Mexico, Guatemala, and Belize are represented by a few specimens.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Extent of occurrence, area of occupancy, number of subpopulations, and population size are very large and probably relatively stable.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No major threats have been identified. Historically, some populations undoubtedly experienced significant declines, particularly in major agricultural regions of intensive cultivation. Remaining populations are extensive and not threatened in most areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: Low

Comments: No major threats have been identified. Historically, some populations undoubtedly experienced significant declines, particularly in major agricultural regions of intensive cultivation. Remaining populations are extensive and not threatened in most areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action, other than clarification of the taxonomic status of various subpopulations. Many occurrences are in national parks and other protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in national parks and other protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Racers have no known neagtive impact on humans. If handled or harassed, they may bite, but will not deliberately confront a human.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Racers are beneficial to humans in that they destroy rodent and insect pests (Harding, 1997).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Racers have no known neagtive impact on humans. If handled or harassed, they may bite, but will not deliberately confront a human.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Racers are beneficial to humans in that they destroy rodent and insect pests (Harding, 1997).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coluber constrictor

Coluber constrictor is a species of nonvenomous, colubrid snake, endemic to North America and Central America. Eleven subspecies, including the nominotypical subspecies, are recognized, which as a group are commonly referred to as the eastern racers.

Geographic range[edit]

They are primarily found throughout the United States, east of the Rocky Mountains, but they range north into Canada, and south into Mexico, Guatemala and Belize.

Description[edit]

Adult Eastern racers can typically vary from 50 to 152 cm (20 to 60 in) in total length depending on the subspecies, but a record-sized specimen measured 185.4 cm (73.0 in) in total length.[3][4][5] A typical adult specimen will weigh around 556 g (1.226 lb), with little size difference between the sexes.[6] The patterns vary widely between subspecies. Most are solid-colored as their common names imply: black racers, brown racers, blue racers, or green racers. "Runner" is sometimes used instead of "racer" in their common names. All subspecies have a lighter-colored underbelly: white, a light tan, or yellow in color. Juveniles are more strikingly patterned, with a middorsal row of dark blotches on a light ground color. The tail is unpatterned. As they grow older, the dorsum darkens, and the juvenile pattern gradually disappears.[3]

Behavior[edit]

Closeup of the head of Coluber constrictor mormon

Racers are fast moving, highly active, diurnal snakes. Their diet consists primarily of small rodents, frogs, toads, lizards, and other snakes.[7] Some subspecies are known to climb trees in order to eat eggs and young birds. Juveniles often consume soft-bodied insects, such as crickets and moths[citation needed]. Despite their specific name, constrictor, they do not really employ constriction, instead simply subduing struggling prey by pinning it bodily, pressing one or two coils against it to hold it in place instead of actually suffocating it. Most smaller prey items are simply swallowed alive.

They are curious snakes with excellent vision, and are sometimes seen raising their head above the height of the grass they are crawling in to view what is around them. Aptly named, racers are very fast and typically flee from a potential predator. However, once cornered they put up a vigorous fight, biting hard and often. They are difficult to handle and will writhe, defecate and release a foul smelling musk from their cloaca. Rattling their tails among dry leaves, racers can sound convincingly like rattlesnakes.[8]

Habitat[edit]

Frequently near water but also in brush, trash piles, roadsides, swamps, suburbia; it is the most common snake in residential neighborhoods in Florida. It spends most of its time on the ground, but it's a good tree climber and may be found in shrubs and trees where the calls of birds draw attention to it.[7]

Most racers prefer open, grassland type habitat where their keen eyesight and speed can be readily used, but they are also found in light forest and even semi-arid regions. They are usually not far from an area of cover to hide in.

Reproduction[edit]

Mating takes place in the spring, from April until early June. Around a month later the female will lay anywhere from 3 to 30 eggs in a hidden nest site such as a hollow log, an abandoned rodent burrow, or under a rock. The 8-10" (20–26 cm) long juvenile racers hatch in the early fall. Maturity is reached in approximately 2 years. Racers have been known to lay their eggs in communal sites, where a number of snakes, even those from other species, all lay their eggs together.

Symbol[edit]

"The black racer snake was adopted because it is native to all 88 Ohio counties and is called the 'farmer's friend' because it eats disease-carrying rodents."

Ohio Governor's Residence[9]

The northern black racer is the state reptile of Ohio.[10]

Subspecies[edit]

Northern Black Racer, C. c. constrictor

Gallery[edit]

Notes[edit]

  1. ^ Stejneger, L.H. and T. Barbour. 1917. A Check List of North American Amphibians and Reptiles. Harvard University Press. Cambridge, Massachusetts. 125 pp. (Coluber constrictor, p. 79)
  2. ^ The Reptile Database. www.reptile-database.org.
  3. ^ a b Conant, Roger. 1975. A Field Guide to Reptiles and Amphibians of Eastern and Central North America, Second Edition. Houghton Mifflin. Boston. 429 pp. ISBN 0-395-19977-8 (paperback). (Coluber consrictor constrictor, pp. 178-179 + Plate 26 + Map 139.)
  4. ^ "Species profile: Minnesota DNR". Dnr.state.mn.us. Retrieved May 2013. 
  5. ^ "Southern Black Racer, Racer (Florida Museum)". Flmnh.ufl.edu. Retrieved May 2013. 
  6. ^ Habitat Use and Thermal Ecology of Ratsnakes (Elaphe Obsoleta) and Racers ... - Gerardo L. F. Carfagno - Google Books. Books.google.com. Retrieved May 2013. 
  7. ^ a b "Corkscrew's common snakes: Black Racer (Coluber constrictor priapus)". Corkscrew Swamp Sanctuary. Retrieved May 2013. 
  8. ^ School of Computer Science. "UMass Amherst: The College of Natural Sciences". Umass.edu. Retrieved May 2013. 
  9. ^ "Ohio's state symbols". Ohio Governor's Residence and Heritage Garden. Retrieved February 13, 2011. 
  10. ^ "5.031 State reptile". LAWriter: Ohio Laws and Rles. Lawriter LLC. 2008. Retrieved January 22, 2011. 
  11. ^ Eastern and Western Yellow-bellied Racers, COSEWIC Assessment and Update Status Report

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Crother et al. (in Crother 2008) cited published studies in transferring all Masticophis species to the genus Coluber, but they also stated that there is unpublished evidence that would reject this. Pending publication of further data, we retain Masticophis as a valid genus.

Western populations have been proposed to constitute a distinct species, C. mormon (Fitch et al. 1981), but this distinction has been demonstrated to be invalid (Corn and Bury 1986; see also Greene 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!