Overview

Brief Summary

The human hookworms include the nematode species Ancylostoma duodenale and Necator americanus. A larger group of hookworm species normally infecting non-human animals can invade and parasitize humans or can penetrate the human skin--causing cutaneous larva migrans--but do not develop any further. Hookworm is the second most common human helminthic infection (after ascariasis) and among the most common chronic infections in the world, affecting around three quarters of a billion people in the tropics and subtropics, particularly in China and sub-Saharan Africa (deSilva et al. 2003). Hookworm species are worldwide in distribution, mostly in areas with moist, warm climates. Both N. americanus and A. duodenale are found in Africa, Asia, and the Americas. Necator americanus predominates in the Americas and Australia, while only A. duodenale is found in the Middle East, North Africa, and southern Europe.

Eggs are passed in the stool and under favorable conditions (moisture, warmth, shade), larvae hatch in 1 to 2 days.The released rhabditiform larvae grow in the feces and/or the soil and after 5 to 10 days (and two molts) they become filariform (third-stage) larvae that are infective. These infective larvae can survive 3 to 4 weeks in favorable environmental conditions. On contact with the human host, the larvae penetrate the skin and are carried through the blood vessels to the heart and then to the lungs.They penetrate into the pulmonary alveoli, ascend the bronchial tree to the pharynx, and are swallowed. The larvae reach the small intestine, where they reside and mature into adults. Adult worms live in the lumen of the small intestine, where they attach to the intestinal wall with resultant blood loss by the host. Most adult worms are eliminated in 1 to 2 years, but longevity may reach several years. Some A. duodenale larvae, following penetration of the host skin, can become dormant (in the intestine or muscle). In addition, infection by A. duodenale probably also occurs by the oral and transmammary route. Necator americanus, however, requires a transpulmonary migration phase. Iron deficiency anemia (caused by blood loss at the site of intestinal attachment of the adult worms) is the most common symptom of hookworm infection and can be accompanied by cardiac complications. Gastrointestinal and nutritional/metabolic symptoms can also occur. In addition, local skin manifestations ("ground itch") can occur during penetration by the filariform (L3) larvae and respiratory symptoms can be observed during pulmonary migration of the larvae.

(Primary source: Centers for Disease Control Parasites and Health website)

Loukas et al. (2006) discussed the need for and prospects of developing a human hookworm vaccine. Hotez et al. (2004) provide a broad review of issues related to human hookworm infection.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Human hookworms are found in tropical and subtropical regions between 30° north and south of the equator. Ancylostoma duodenale is found in the Mediterranean region, Southeast Asia, and scattered in the Southern Americas.

Biogeographic Regions: nearctic ; oriental ; ethiopian ; neotropical

  • Beigal, Y., Z. Greenburg, I. Ostfeld. 2000. Letting the Patient off the Hook. The New England Journal of Medicine, 342(22): 1658-1661.
  • Changhua, L., Z. Xiaorong, Q. Dongchuan, X. Shuhua, P. Hotez. 1999. Epidemiology of human hookworm infections among adult villagers in Hejiang and Santai Counties, Sichuan Province, China. Acta Tropica, 73: 243-249.
  • Roberts, L., J. Janovy Jr.. 2000. Foundations for Parasitology. Boston: McGraw Hill Companies, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ancylostoma duodenale is an S-shaped worm because of its flexure at the frontal end. The worm is pinkish-white. Adult male hookworms range in size from 8-11 mm long, whereas adult females range in size from 10-13 mm long. This species is dimorphic, with the males having bursa characteristics and needle-like spicules with small tips, which are distally fused. Females have a vulva located approximately one-third of the body length from the posterior end. Both male and female hookworms have two powerful ventral teeth in the adult forms of the parasite, one along each side of the buccal capsule; smaller pairs of teeth are located deeper in the capsule.

Hookworm eggs have a thin shell and the larvae possess   amphids, large paired sensilla on each side of the mouth, which allow them to locate their host. The larvae are rod-shaped and are about 0.004 cm long.

Range length: 8 to 13 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Ashton, F., G. Schad, J. Li. 1999. Chemo- and thermosensory neurons: structure and function in animal parasitic nematodes. Veterinary Parasitology, 84: 297-316.
  • Carson-DeWitt, R. 1999. Pp. 1475 in Gale Encyclopedia of Medicine, 1st Edition. U.S.: Gale Research, Inc..
  • D.W., 1980. The Encyclopedia of the Animal World, Vol.5. U.S.: Bay Books.
  • Williams, G. 1969. The Plague Killers. U.S.: Charles Scribner's Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Along with its range of definitive hosts, Ancylostoma duodenale also has a range of paratenic hosts of canids and felids, where it may remain for intervals of time until it reaches the definitive host. In the paratenic host it may survive in the muscles where it is then transferred to humans via undercooked meat, including rabbit, lamb, beef, and pork. The eggs of Ancylostoma duodenale are still within the muscle and are ingested with the meat, allowing for the adults to develop within the intestinal tract.

Juveniles of the species reside in the warmer regions of the world where the soil is preferably humus and loose with reasonable water drainage and good aeration. Oxygen is necessary for the development of the eggs, whose metabolism is aerobic.

Hookworm eggs derive their nutrition from the host feces via absorption. Therefore they must live in areas with soils of neutral pHs and in shady areas, such as coffee, banana, and sugar plantations where the feces will remain intact long enough for them to develop into juveniles. They are extremely sensitive to sunlight, which can ultimately kill the juveniles. Juveniles are also sensitive to high salt concentrations and acidic pHs of soils.

After penetrating the skin, juveniles attach to blood vessels and begin to feed until reaching the adult stage. Adult females remain attached and the males detach to find their mates. Continual reinfection is promoted by repeated defecation by infected individuals in the same locals where they were originally infected. This may even lead to epidemics of Ancylostoma duodenale infections in arid regions of the world.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural

  • Chilton, N., R. Gasser. 1999. Sequence differences in the internal transcribed spacers of DNA among four species of hookworm. International Journal for Parasitology, 29: 1971-1977.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The definitive host is where the parasite reaches sexual maturity. Humans are the definitive hosts of Ancylostoma duodenale. Recent research shows that other definitive hosts may exist because of the ability to cross-infect different hosts. For example, Ancylostoma duodenale posses the ability to cross-infect from humans to canines, whereas its close relative, Ancylostoma caninum, cannot cross-infect to humans.

Hookworm eggs gain nutrition via the host feces. After penetrating the skin, juveniles attach to blood vessels and begin to feed.

The larval stage is free-living where there is independent existence in the soil. They then penetrate the host's skin by the secretion of digestive enzymes that dissolve the skin.

Young and adult worms feed on blood from the walls of the host's intestine by attaching to the intestinal lining via their sharp buccal cavity teeth, which they also use to break open small blood vessels so that they can suck the blood from them. Ancylostoma duodenale possess anticoagulant substances that are secreted to prevent blood clotting to the blood flowing from the wound.

Animal Foods: blood; body fluids

Other Foods: dung

Primary Diet: carnivore (Eats body fluids)

  • Brinksworth, R., S. Harrop, P. Prociv, P. Brindley. 2000. Host specificity in blood feeding parasties: a defining contribution by haemoglobin-degrading enzymes?. International Journal for Parasitology, 30: 785-790.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Ancylostoma duodenale mainly infects humans but paratenic hosts include canids and felids, where it may remain for intervals of time until it reaches the definitive host.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

These parasites are probably not preyed on directly, but are ingested from host to host. Larval mortality is high as most of the parasites do not reach appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The larvae of the infective stage are usually stationary, until they sense vibrations in the soil as heat or carbon dioxide. They use environmental signals to flag their host and prepare for ingestion during their third larval stage. They do so by using neurons with dendritic processes that resemble cilia, which are mechanosensory, thermosensory and chemosensory.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: infrared/heat ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

The hookworm life cycle is composed of seven steps, which are as follows. First, the Ancylostoma duodenale eggs are passed into the feces of the host. Second, the embryo passes via and develops within the feces. The first stage rhabditiform juvenile then hatches once the egg is outside of the host. Next, the filariform or infective juvenile develops after two molts. This stage is characterized by an arrest in development until a new host is reached. Humans may be infected via the oral cavity by ingestion of undercooked meat. Filiform juveniles infect by directly penetrating the skin of the host, usually a human. Fifth, the juveniles then migrate through the circulatory system until they reach the lungs. Sixth, once they have reached the lungs, the juveniles leave the circulatory system by finding their way into the alveoli and then migrating to the small intestine via the trachea. It takes about 5-6 weeks for the hookworm to reach the small intestine from the lungs. Finally, the adult worms develop in the small intestine where they mate, and produce eggs that are sent off in the feces of the host to begin the process once more. Adults form about 6 weeks after the initial infection.

A possible alternate root of infection may occur if juveniles are swallowed and develop normally without moving into the lungs. However, this is a very rare occurrence.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Both males and females attach to the intestinal walls during their life span, but the male leaves at one point to search for a female to mate with. The average female life span is about one year, during which it may lay from 10,000-30,000 eggs a day during its adult life.

Females may produce a phermomone to attract males. The male   coils around a female with his curved area over the female genital pore. The gubernaculum, made of cuticle tissue, guides spicules which extend through the cloaca and anus. Males use spicules to hold the female during copulation. Nematode sperm are amoeboid-like and lack flagella.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

There is no parental investment beyond egg laying.

Parental Investment: pre-fertilization (Provisioning)

  • Barnes, R. 1987. Invertebrate Zoology. Orlando, Florida: Dryden Press.
  • Beigal, Y., Z. Greenburg, I. Ostfeld. 2000. Letting the Patient off the Hook. The New England Journal of Medicine, 342(22): 1658-1661.
  • D.W., 1980. The Encyclopedia of the Animal World, Vol.5. U.S.: Bay Books.
  • Roberts, L., J. Janovy Jr.. 2000. Foundations for Parasitology. Boston: McGraw Hill Companies, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ancylostoma duodenale

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTAATTTATATAAAAAATATCAAGGTGGTTTAGCAACTTGATTAGAAAGGTCTAATCATAAGGATATTGGTACGTTGTATTTTTTGTTTGGTTTGTGATCAGGTATGGTTGGTACTAGGTTGTCTTTGATTATTCGTTTGGAGTTGGCAAAACCTGGTTTGTTGTTGGGTAATGGTCAGTTATATAATTCTATTATTACGGCTCATGCTATTTTAATGATTTTTTTTATGGTAATGCCAACTATGATTGGTGGTTTTGGTAATTGAATGGTTCCTTTAATGTTGGGTGCCCCAGATATGAGATTTCCTCGTTTAAATAATTTGAGTTTTTGATTATTAGGTACTGATATGTTTTTGATTTTAGATTCTTGTTTTGTTGATATAGGTTGTGGTACTAGGTGAACAGTTTATCCTCCTTTAAGGACTTTGGGTCATCCAGGGAGAAGGGTTGATTTGGCTATTTTTAGTTTACATTGTGCTGGTTTAAGGTCTATTTTGGGTGGTATTAATTTTATGTGTACCACAAAGAATTTGCGTAGTAGTTCTATTTCTTTGGAGCATATAAGTTTATTTGTGTGAACTGTATTTGTTACAGTTTTTTTATTGGTTTTATCTTTACCTGTATTGGCTGGTGCTATTACGATGTTGTTAACGGATCGTAATTTAAATACTTCTTTTTTTGACCCTAGAACTGGGGGTAATCCTTTAATTTATCAACATTTGTTTTGATTTTTTGGTCATCCTGAGGTTTATATTTTGATTTTACCAGCTTTTGGTATTGTTAGTCAGTCTACTTTATATTTAACAGGTAAAAAAGAAGTATTTGGTTCTTTGGGTATGGTTTATGCAATTTTAAGTATTGGTTTGATTGGTTGTGTAGTGTGAGCTCACCATATGTATACTGTAGGTATGGATTTGGATTCTCGTGCTTATTTTACGGCTGCAACTATGGTGATTGCTGTTCCAACTGGTGTAAAAGTTTTTAGGTGGTTAGCCACATTATTTGGTATAAAAATGATTTTTCAACCTTTATTATTGTGGGTTTTGGGTTTTATTTTTTTGTTTACTATTGGTGGTTTAACTGGTGTTGTATTGTCAAATTCAAGGTTGGATATTATTTTACATGATACTTATTATGTTGTAAGTCATTTTCATTATGTTTTAAGTTTAGGTGCTGTGTTTGGTATTTTTACAGGTATTAGTTTATGGTGAAGGTTTATGACAGGTTATGTTTATGATAAGTTAATAATATCTTCTGTATTTTTTTTGATATTTGTGGGTGTTAATTTAACATTTTTTCCTTTGCATTTTGCTGGTTTACATGGTTTTCCTCGTAAGTATTTGGATTATCCTGATGTGTATTCTGTTTGAAATGTGATGTCTTCATATGGCTCAATAATTAGAGTTTTTGCTCTGTTTTTGTTTTTATATGTTTTGTTTGAGTCTTTTTTTAGTTATCGTTTGGTTTTGAGTGATAATTTTATTAATAGGAGACCTGAGTATAGGTTAAGAAGTTATGTGTTTGGTCATAGTTATACGTCTGAGATTTATTTTAGATGTTCTGTTTTAAAATTATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ancylostoma duodenale

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Infected individuals are susceptible to malnutrition, protein and iron drain from the diet. Other effects include stunted growth and below-average intelligence in developing children, lowered antibody response to infectious agents, and anemia due to heavy blood loss and iron-deficiency among other side-effects. In some cases, heavy infestations may lead to fatalities because of infection of other worms or malaria as well as excess blood loss and other types of complications. Infants were recently recognized in the field of public health as being vulnerable. Hookworm disease is more prevalent in females than males.

Tourists visiting areas where local sanitation is a problem should be careful of infestation, especially in regions with humid climates.

Treatment is fairly simple with Mebendazole, Albendazole, and Levamisole. The use of dietary supplementation is important to compensate for the loss in nutrients.

Negative Impacts: injures humans (causes disease in humans )

  • Sen-Hai, Y., J. Ze-Xiao, X. Long-Qi. 1995. Infantile Worm disease in China. Acta Tropica, 59: 265-270.
  • Bennett, A., H. Guyatt. 2000. Reducing intestinal nematode infection: efficacy of albendazole and mebendazole (Review). Parasitology Today, 16: 71-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ancylostoma duodenale

Ancylostoma duodenale is a species of the worm genus Ancylostoma. It is a parasitic nematode worm and commonly known as Old World hookworm. It lives in the small intestine of hosts such as humans, cats and dogs, where it is able to mate and mature. Ancylostoma duodenale and Necator americanus are the two human hookworms that are normally discussed together as the cause of hookworm infection. They are dioecious.[1] Ancylostoma duodenale is abundant throughout the world, including in the following areas: southern Europe, north Africa, India, China, southeast Asia, some areas in the United States, the Caribbean, and South America.

Characteristics[edit]

Ancylostoma duodenale is small cylindrical worm, greyish-white in color. It has two ventral plates on the anterior margin of the buccal capsule. Each of them has two large teeth that are fused at their bases. A pair of small teeth can be found in the depths of the buccal capsule. Males are 8 mm to 11 mm long with a copulatory bursa at the posterior end. Females are 10 mm to 13 mm long, with the vulva located at the posterior end; females can lay 10,000 to 30,000 eggs per day. The average lifespan of Ancylostoma duodenale is one year.

When a filariform larva (infective stage) penetrates the intact skin, the larva enters the blood circulation. It is then carried to the lungs, coughed up, and swallowed back into the small intestine. The larva later matures into an adult in the small intestine and female worms can lay 25,000 eggs per day. The eggs are released into the feces and reside on soil. Embryonated eggs on soil will hatch into juvenile 1 stage (rhabditiform or noninfective stage) and mature into filariform larvae. The filariform larvae can then penetrate another exposed skin and begin a new cycle of infection.

Ancylostoma duodenale is prevalent in southern Europe, northern Africa, India, China, and southeast Asia, small areas of United States, the Caribbean islands, and South America. This hookworm is well known in mines because of the consistency in temperature and humidity that provide an ideal habitat for egg and juvenile development. It is estimated 1 billion people are infected with hookworms. Transmission of Ancylostoma duodenale is by contact of skin with soil contaminated with larvae.

Infection[edit]

Light infection causes abdominal pain, loss of appetite and geophagy. Heavy infection causes severe protein deficiency or iron deficiency anemia. Protein deficiency may lead to dry skin, edema and potbelly, while iron deficiency anemia might result in mental dullness and heart failure.

The eggs of Ancylostoma duodenale and Necator americanus cannot be distinguished. Larvae cannot be found in stool specimen unless they are left at ambient temperature for a day or more.

Education, improved sanitation and controlled disposal of human feces are important. Wearing shoes in endemic areas can reduce the prevalence of infection as well.

Ancylostoma duodenale can be treated with albendazole, mebendazole and benzimidazoles. Pyrantel pamoate is an alternative. In severe cases of anemia, blood transfusion may be necessary.

Notes[edit]

  1. ^ "Ancylostoma duodenale". Archived from the original on 1 March 2009. Retrieved 2009-01-22. 

References[edit]

  • Hotez, P. J., and D. I. Pritchard. 1995(June). Hookworm infection. Sci. Am. 272:68–74.
  • Looss, A. 1898. Zur Lebensgeschichte des Ankylostoma duodenale. Cbt. Bakt. 24:441–449, 483–488.
  • Murray, P. R., K. S. Rosenthal, and M. A. Pfaller. 2009. Medical Mirobiology, 6th ed. Elsevier/Mosby Publishing Company, Philadelphia, U.S.A., 865 p.
  • Schmidt, G.D., and L. S. Roberts. 2009. Foundations of parasitology, 8th ed. McGraw-Hill Companies, New York,p. 472–473.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!