Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:890
Specimens with Sequences:1265
Specimens with Barcodes:576
Species:49
Species With Barcodes:46
Public Records:135
Public Species:23
Public BINs:19
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Craugastor cf. azueroensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCCTGTTTGGGGCCTGAGCAGGTATGGTCGGCACCGCCCTCAGCCTCCTAATTCGAACTGAACTAGCTCAGCCCGGCTCACTACTCTGCGACGATCAAGTCTACAACGTAATTGTTACAGCCCATGCCTTCGTCATAATCTTTTTCATGGTGATACCAGTTATAATCGGAGGGTTCGGCAATTGACTCGTCCCTCTGATGATTGGCGCCCCTGACATAGCTTTCCCACGCATAAACAACATAAGCTTCTGACTATTACCTCCATCATTTATTCTTCTTCTGGCTTCCACCGGAATTGAAGCGGGAGCTGGAACAGGATGAACAGTTTACCCCCCCCTGGCAGCTAATCTAGCCCACGCAGGGCCATCAGTTGACTTAACCATCTTCTCCCTCCACTTGGCCGGAGTCTCCTCTATTTTGGGGGCAATCAACTTCATCACCACAATTCTTAACATGAAACCTCTCTCCCTCACTCAATATCAAACACCACTTTTCGTCTGATCCGTCCTCATCACTGCTGTTCTTCTACTCTTATCCCTCCCAGTCCTCGCCGCCGGGATTACTATACTTTTAACTGATCGAAACCTTAATACGACCTTCTTTGACCCTGCTGGGGGTGGAGACCCCATTCTCTATCAACACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Craugastor cf. azueroensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Craugastor

Craugastor is a large genus of frogs in the Craugastoridae family.[1][2] It has over 120 species. Its scientific names means brittle-belly, from the Ancient Greek krauros (κραῦρος, brittle, dry) and gastēr (γαστήρ, belly, stomach).[3]

It contains these species:

References[edit]

  1. ^ Hedges, S. B., Duellman, W. E., and Heinicke, M. P (2008). "New World direct-developing frogs (Anura: Terrarana): Molecular phylogeny, classification, biogeography, and conservation". Zootaxa (1737): 1–182. 
  2. ^ "Craugastoridae. in: AmphibiaWeb - Information on Amphibian Biology and Conservation". University of California, Berkeley, CA. Retrieved 2010-07-13. 
  3. ^ Dodd, C. Kenneth (2013). Frogs of the United States and Canada 1. The Johns Hopkins University Press. p. 20. ISBN 978-1-4214-0633-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!