Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

North American Ecology (US and Canada)

Resident of southern Florida but strays throughout much of the US (Scott 1986). Habitats are WOODS. Host plants are usually trees with only a few host species known, including from Capparidaceae. Eggs are laid on the host plant in clutches of 2-3. There are multiple flights all year long in southern Florida (Scott 1986). Considered as Appias drusilla by some sources (Scott 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) In North America, southern Florida (resident) and southern Texas (probably does not survive the coldest winters). Mainly Latin America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Shaded hardwood hammocks, evergreen river forests, open areas with flowers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Males patrol for females (Scott, 1986).
  • Scott, J. A. 1986. The butterflies of North America. Stanford University Press.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leslie Ries

Partner Web Site: North American Butterfly Knowledge Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Appias drusilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTTTATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACATCTCTAAGTTTATTAATTCGAACAGAATTAGGAAACCCTGGGTCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATACTTGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTACTTCCCCCTTCTTTAACATTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGTGGTTCTTCTGTTGACTTAGCTATTTTTTCTTTACACTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTCTTTTTGTTTGAGCTGTTGGTATTACTGCTCTTCTTCTTCTTCTTTCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCCTTCTTTGATCCCGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTCTACCTGGATTTGGAATAATTTCCCATATTATTTCTCAAGAAAGAGGAAAAAAGGAAACTTTTGGATCTTTAGGAATAATTTATGCTATAATAGCAATTGGACTTTTAGGGTTTATTGTTTGAGCACATCATATATTTACTGTTGGAATGGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Appias drusilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Glutophrissa drusilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTAGGAACATCTCTAAGTTTATTAATTCGAACAGAATTAGGAAACCCTGGGTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCNCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATACTTGGAGCCCCTGANATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTACTTCCCCCTTCTTTAACATTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGTGGTTCTTCTGTTGACTTAGCTATTTTTTCTTTACACTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTCTTTTTGTTTGAGCTGTTGGTATTACTGCTCTTCTTCTTCTTCTTTCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCCTTCTTTGATCCCGCTGGAGGAGGAGATCCTANNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Glutophrissa drusilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Recently ranked S2S3 in Floirda, but probably secure in most of its range in Central and South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Needs: Three or four in Florida Keys, but widespread in tropics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Appias drusilla

Appias drusilla, the Florida White or Tropical White, is a butterfly in the Pieridae family. It is found in tropical America from Brazil north to southern peninsular Florida and the Florida Keys and Antilles. It frequently visits coastal Texas and is a rare stray to Nebraska and Colorado. The habitat consists of tropical lowland evergreen or semideciduous forests.[2]

The wingspan is 53–77 mm (2.1–3.0 in). Males are solid white on both the upper and lower surfaces of the wings except for a narrow edging of black along the forewing costal margin. The female has two forms: the dry-season form is all white and the wet season form has black along the forewing costal margin and a yellow-orange upper hindwing. The dry-season form is on wing from October to April and the wet-season form from May to September. They feed on flower nectar from a variety of weeds and garden plants including Lantana and Eupatorium.[2]

The larvae feed on Brassicaceae species, including Drypetes lateriflora and Capparis flexuosa in Florida. They are shade-loving and feed during the night and on cloudy days.[2]

Subspecies[edit]

The following subspecies are recognised:[1]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!