Overview

Brief Summary

Remarks: HURTADO et al. (2004) found a very significant mitochondrial divergence between north and south EPR populations, leading to hypothesize the presence of a southern cryptic species, although no significant morphological differences have been detected.
  • CARY C.S., SHANK T. & J. STEIN (1998) Nature 391: 545-546.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Dwelling inside organic tubes in active chimney walls. Temperature ranging from 10-80°C (debated?). Feeding on free bacteria, associated with filamentous bacteria epibiosis. Functional gut, retractile buccal tentacles, gonochoric, sexual dimorphism.
  • CARY C.S., SHANK T. & J. STEIN (1998) Nature 391: 545-546.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description of Alvinella pompejana

This species reported from hot hydrothermal vent habitats. Up to 13 centimetres (5 inches) long, pale grey with "hairy" backs; these "hairs" are formed by bacteria which are thought to afford the worm some degree of insulation. Glands on the worm's back secrete a mucus which the bacteria feed on. Also known as Pompeii worms, they form large aggregate colonies enclosed in delicate, paper-thin tubes. Pompeii worms get their name from the Roman city of Pompeii that was destroyed during an eruption of Mount Vesuvius in AD 79. Attaching themselves to black smokers, the worms have been found to thrive at temperatures of up to 80 degrees C (176 degrees F), making the Pompeii worm the most heat-tolerant complex animal known to science. They were first discovered at hydrothermal vents off the Galapagos. Thought to subsist on vent microbes, the Pompeii worm pokes its feather-like head out of its tube home to feed and breathe. The plume of tentacle-like structures on the head are gills, coloured red by haemoglobin. It is the posterior end that is exposed to extreme temperatures; the anterior end stays at a much more comfortable 22 degrees C (72 degrees F).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

biopedia

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North East Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East Pacific Rise: 21°N to 23°S (not observed in Guaymas Basin and Galapagos Spreading Center).
  • CARY C.S., SHANK T. & J. STEIN (1998) Nature 391: 545-546.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Tube dwelling polychaetes with four pairs of lamellate branchiae; two transformed chaetigerous segments; body tappering posteriorly, no obvious abdominal part; bacterial epibiosis on the dorsum. Retractile buccal tentacles and two specialized sexual ones.
  • CARY C.S., SHANK T. & J. STEIN (1998) Nature 391: 545-546.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Up to 150 mm.
  • CARY C.S., SHANK T. & J. STEIN (1998) Nature 391: 545-546.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Alvinella pompejana Desbruy?res & Laubier, 1980
Catalog Number: USNM 59828
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): D. Desbruy?res
Locality: New Hydrothermales Vents, North Pacific Ocean
Depth (m): 2593 to 2593
Vessel: Alvin DSR/V
  • Holotype: Desbruy?res, D. & Laubier, L. 1980. Alvinella pompejana gen. sp. nov., Ampharetidae aberrant des sources hydrothermales de la ride Est-Pacifique. Oceanologica Acta. 3 (3): 267-274.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 37 samples.

Environmental ranges
  Depth range (m): 2493.5 - 2700
  Temperature range (°C): 1.823 - 2.075
  Nitrate (umol/L): 35.653 - 41.112
  Salinity (PPS): 34.663 - 34.674
  Oxygen (ml/l): 2.461 - 3.601
  Phosphate (umol/l): 2.483 - 2.812
  Silicate (umol/l): 126.847 - 161.139

Graphical representation

Depth range (m): 2493.5 - 2700

Temperature range (°C): 1.823 - 2.075

Nitrate (umol/L): 35.653 - 41.112

Salinity (PPS): 34.663 - 34.674

Oxygen (ml/l): 2.461 - 3.601

Phosphate (umol/l): 2.483 - 2.812

Silicate (umol/l): 126.847 - 161.139
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alvinella pompejana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 40 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATACTTCCTATTTGGTATTTGGGCAGGTCTTGTAGCTACTTCTACTAGACTTATCATTCGAACTGAACTTGGACAACCAGGATCATTCCTAGGAGAT---GATCAACTATACAACACAATCATTACAGCCCACGGTCTTCTAATGCTATTCTTCTTCGTAACACCTATCTTTATAGGAGGTTTCGCCAACTGATTACTTCCTCTAATGATCGGTGCCCCAGATATGGCATTCCCTCGAGTAAATAATCTAGGATTCTGACTTCTTCCTCCTGCACTAACACTTCTTATTGCCTCTGCGGCAGTTGAAAAAGGTGTAGGTACCGGTTGAACAATCTATCCCCCTCTAGCTGGAAACATGGCCCATGCTGGCCCCTCTGTTGATCTAGCAATTTTCTCACTCCATCTAGCCGGTGTATCATCGATTCTAGGCTCAATTAACTATATTACAACTGTAATAAACATGCGACCTAAAGGAATGAACTTCGAATCAGTTCCTCTATTCGTATGAGCCGTTAAAATTACTGCTATTCTACTGCTACTATCTCTTCCTGTATTCGCCGGTGCTATTACTATGCTACTAACAGATCGAAACATGAACACATCATTCTTCGACCCATCCGGAGGTGGTGATCCCGTTCTATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alvinella pompejana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pompeii worm

The Pompeii worm, Alvinella pompejana, is a species of deep-sea polychaete worm (commonly referred to as "bristle worms"). It is an extremophile found only at hydrothermal vents in the Pacific Ocean, discovered in the early 1980s off the Galápagos Islands by French marine biologists.

Contents

Introduction

In 1980 Daniel Desbruyères and Lucien Laubier, just few years after the discovery of the first hydrothermal vent system, identified one of the most heat-tolerant animals on Earth — Alvinella pompejana, the Pompeii worm.[1] It was described as a deep-sea polychaete that resides in tubes near hydrothermal vents, along the seafloor. In 1997, marine biologist Craig Cary and colleagues found the same worms in a new section of Pacific Ocean, near Costa Rica, also attached to hydrothermal vents. The new discovery and subsequent work led to important progress in the scientific knowledge of these special worms.[2]

They can reach up to 5 inches in length and are pale gray, with red tentacle-like gills on their heads. Perhaps most fascinating, their tail ends are often resting in temperatures as high as 176°F (80°C), while their feather-like heads stick out of the tubes into water that is a much cooler, 72°F (22°C). Scientists are attempting to understand how Pompeii worms can withstand such extreme temperatures by studying the bacteria that form a "fleece-like" covering on their backs. Living in a symbiotic relationship, the worms secrete mucus from tiny glands on their backs to feed the bacteria, and in return, they are protected by some degree of insulation. The bacteria have also been discovered to be chemolithotrophic, contributing to the ecology of the vent community. Recent research suggests the bacteria might play an important role in the feeding of the worms.[3]

Attaching themselves to black smokers, the worms have been found to thrive at temperatures of up to 80°C (176°F), making the Pompeii worm the most heat-tolerant complex animal known to science after the tardigrades (or water bears), which are able to survive temperatures over 150°C.

Biology

Reaching a length of up to 13 cm (5 in), Pompeii worms have "hairy" backs; these "hairs" are actually colonies of bacteria, which are thought to afford the worm some degree of insulation. Glands on the worm's back secrete a mucus on which the bacteria feed, a form of symbiosis. The Pompeii worms form large, aggregate colonies enclosed in delicate, paper-thin tubes.

The Pompeii worm has a feather-shaped head. The plume of tentacle-like structures on it are gills, coloured red by hemoglobin.

Name

Pompeii worms get their name from the Roman city of Pompeii that was destroyed during an eruption of Mount Vesuvius in AD 79. Its family name Alvinellidae and genus name Alvinella both derive from DSV Alvin, the three-person submersible vehicle used during the discovery of hydrothermal vents and their fauna during the late 1970s. The family Alvinellidae contains eight other species, but none matches the Pompeii worm's heat tolerance.

Symbiotic bacteria

While it is not yet known precisely how the Pompeii worm survives these severe vent conditions, scientists suspect the answer lies in the fleece-like bacteria on the worm's back; this layer may be up to 1 cm thick. The bacteria may possess special proteins, "eurythermal enzymes", providing the bacteria—and by extension the worms—protection from a wide range of temperatures. The bacteria may also provide thermal insulation. Studies are hampered by the difficulties of sampling; to date, Pompeii worms have not survived decompression.

Study of the Pompeii worm's seemingly life-sustaining bacteria could lead to significant advances in the biochemical, pharmaceutical, textile, paper, and detergent industries.

Behavior

Pompeii worms simultaneously keep their heads (including the gills) in much cooler water while their tails are exposed to hot water. Since their internal temperature has yet to be measured, a Pompeii worm may survive exposure to hot water by dissipating heat through its head to keep its internal temperature within the realm previously known to be compatible with animal survival.

Thought to subsist on vent microbes, the Pompeii worm pokes its head out of its tube home to feed and breathe. Its posterior end is exposed to extreme temperatures; the anterior end stays at a much more comfortable 22°C (72°F).

References

  1. ^ D.Desbruyères, L.Laubier - Alvinella pompejana gen.sp. nov., Ampharetidae aberrant des sources hydrothermales de la ride Est-Pacifique - Oceanologica Acta, 1980
  2. ^ NSF-OLPA - Scientists Succeed at First-Ever Attempt to Sequence DNA at Sea (2001)
  3. ^ Grzymski, J. J.; et al. (2008). "Metagenome analysis of an extreme microbial symbiosis reveals eurythermal adaptation and metabolic flexibility". PNAS 105 (45): 17516–17521. doi:10.1073/pnas.0802782105. PMID 18987310. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!