Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Range Description

Sinaloa (Mexico) to the Guianas, Suriname, Brazil, Northern Argentina, Paraguay, Bolivia, Ecuador and Peru; Trinidad; Greater and Lesser Antilles; S Bahamas (Simmons 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Noctilo leporinus is found in tropical and subtropical parts of the New World from Southern Vera Cruz (Mexico) to Northern Argentina and Southeastern Brazil. This species is also found on the Greater and Lesser Antilles, and the Bahamas.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The sexes are slightly dimorphic in size, the males averaging larger than the females. A male weighing 78 g, and a female weighing 60 g were reported by Klingener, Genoways, and Baker (1978). Head and body length is 98 to 132 mm, and forearm length measures 70 to 92 mm.

The sexes are also dimorphic in color, with males having reddish to orange pelage dorsally, and females generally having greyish or dull brown fur. Both males and females tend to have paler underparts, and the pelage is extremely short.

Noctilionids have a pointed muzzle and lack a nose leaf. The nose is somewhat tubular and projects slightly beyond the lips. Upper lips are smooth but divided by a "hare lip", a vertical fold of skin under the nostrils. The lips are also large and swollen in appearance, suggesting the common name, greater bulldog bat.

This bat presents a formidable dentition. Its cheeks are elastic and can be greatly expanded. Internal cheek pouches are present. The ears are large, slender, pointed, and separate. There is also a tragus which has a serrated margin.

Noctilio leporinus has wings which are long and quite narrow, being more than two and a half times the length of the head and body. Nearly 65% of the wingspan is composed of the third digit.

The tail is more than half as long as the thigh bone. It extends to about the middle of a well-developed uropatagium, or tail membrane. The tail tip is free, protruding for about 10 to 15 mm from the dorsal surface of this membrane. The uropatagium is supported by the legs, tail, and calcar, or heel extension. The calcar is a cartilaginous structure that articulates with the heel bone (calcaneum) and is unique to bats. In this fishing species, the calcar is large and serves to hold the uropatagium out of the water as the bat flies close to the surface.

Noctilio leporinus has unusually long hind limbs and very large hind feet with strong gaff-like claws. Fishing bats tend to have hind feet 1.8 to 3.9 times larger than related non-fishing bats.

Range mass: 60 to 78 g.

Range length: 98 to 132 mm.

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Average basal metabolic rate: 0.4 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Hollow trees, caves, piscivore, can eat aquatic insects. Observed in groups larger than 30 individuals in Brazil (Barquez 1999). They roost near streams, coastal marine habitats, major river basins, or other moist places. Bachelor males roost apart from females. Males residing with female groups stay for two or more reproductive seasons (Mulheisen and Berry 2000). Females bear a single young each pregnancy. This species tends to have pregnancies occuring from September until January, and lactation is first seen in November and continues until April. This is a general pattern, however, and it can vary with geographical location. Reproduction corresponds to seasons of greatest food availability (Mulheisen and Berry 2000).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

They roost near streams, coastal marine habitats, major river basins, or other moist places.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Noctilio leporinus catches and consumes fish. It is one of about six bat species that regularly eat fish. It will also eat aquatic crustaceans, stinkbugs, crickets, scarab beetles, moths, winged ants, and other insects, but primarily, it is a piscivore (fish-eater).

Animal Foods: fish; insects; terrestrial non-insect arthropods; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
11.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.8 years (captivity) Observations: Two wild-caught animals lived about 11.8 years at Bronx Zoo (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Bachelor males roost apart from females. Males residing with female groups stay for two or more reproductive seasons. Female N. leporinus bear a single young each pregnancy. This appears to form the basis of a polygynous social organization.

This species tends to have pregnancies occuring from September until January, and lactation is first seen in November and continues until April. This is a general pattern, however, and it can vary with geographical location. Reproduction corresponds to seasons of greatest food availability.

Young bats don't leave the roost for their first attempts at sustained flight until nearly adult size. At that time they are slightly less than one month of age and the parents have remained at the roost throughout. This suggests a high degree of bi-parental care which may be a characteristic of this species.

Breeding interval: These bats apparently breed once per year.

Breeding season: Pregnancies occur from September until January, although the time of mating is apparently unreported in the literature.

Range number of offspring: 1 to 1.

Average gestation period: 2 months.

Average time to independence: 1 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Noctilio leporinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNTATTTACTATTCGGTGCCTGAGCCGGAATAGTAGGAACCGCCCTAAGCCTAATCATCCGAGCAGAATTAGGTCAACCAGGCACTTTGCTTGGTGATGACCAAATTTATAATGTCGTAGTAACAGCCCACGCTTTCGTAATAATTTTCTTTATAGTAATACCTATTATAATCGGAGGGTTTGGCAATTGATTAGTTCCATTAATAATTGGGGCACCAGACATGGCCTTCCCTCGAATAAATAATATAAGCTTTTGACTACTCCCCCCATCTTTCCTATTACTACTAGCCTCCTCAATAGTTGAAGCCGGGGCAGGGACCGGATGAACCGTCTACCCTCCTTTAGCAGGCAACTTAGCCCACGCCGGAGCTTCAGTAGATCTTGCAATTTTCTCTCTTCACCTAGCAGGGGTCTCATCCATTCTTGGCGCTATTAATTTCATTACAACTATTATTAATATAAAACCCCCAGCTCTCTCCCAATATCAAACTCCCCTATTCGTATGATCAGTACTAATTACAGCCGTTCTACTTTTACTGTCCCTTCCTGTGCTAGCTGCGGGCATCACTATACTACTAACAGACCGAAACCTAAATACCACTTTCTTTGACCCTTGTGGAGGAGGAGATCCAATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Noctilio leporinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 33
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Perez, S., Miller, B. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These bats have no special conservation status. However, one report on the island of Curacao, Netherlands Antilles, showed that uncontrolled cave disturbance and removal of resources through development has brought about an apparent decrease in bat numbers.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant. Rare in Argentina (Barquez pers. comm.). Large roosts of hundreds of bats have been reported. They may also roost in smaller groups of up to 30 individuals and forage at night in groups of 5 to 15 animals (Mulheisen and Berry 2000).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats throughout its range. In Guatemala fishfarmers are killing this species (Cajas pers. comm.). Water bodies pollution (Armando Rodriguez pers. comm.). In Belize the water level changed and restricted the range (Miller pers. comm.). Deforestation (Uribe and Castro-Arellano, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Found in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Groups of Noctilio leporinus may take significant numbers of small fish from hatcheries and aquaculture projects. Methods for blocking echolocation over hatchery ponds can be effective in preventing these losses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Greater bulldog bat

The greater bulldog bat or fisherman bat (Noctilio leporinus) is a type of fishing bat native to Latin America. The bat uses echolocation to detect water ripples made by the fish upon which it preys, then uses the pouch between its legs to scoop the fish up and its sharp claws to catch and cling to it. It is not to be confused with the lesser bulldog bat, which, though belonging to the same genus, merely catches water insects, such as water striders and water beetles.

It emits echolocation sounds through the mouth like Myotis daubentoni, but the sounds are quite different, containing a long constant frequency part around 55 kHz, which is an unusually high frequency for a bat this large.

Contents

General description

The greater bulldog bat is a large bat, often with a combined body and head length of 10.9 to 12.7 cm (4.6 to 5 in). It generally weighs from 50–90 grams.[3] Males tend to be larger than females, with the former averaging 67 grams and the latter averaging 56 grams.[4] They also differ in fur color. Males have bright orange fur on the back while females are dull gray.[5] However, both sexes have pale undersides and may have a pale line that runs down the middle of the back.[5] The bulldog bat has rounded nostrils that open forward and down. It has elongated, pointed ears with a tragus that gets ridged at the outer edge. The bulldog bat has smooth lips but its upper lip is divided by a skin fold while its bottom lip has a wart above skin folds that extend to the chin.[5] It is these features that give the bulldog bat gets its name, as it resembles a bulldog.

The bulldog bat has a wingspan of 1 meter (3 feet). The wing of the bat is longer than the head and body combined and 65% of its wingspan is made of the third digit.[6] When in flight, the bat's wings move slowly.[6] This species is a capable swimmer and will use its wings to paddle.[5] The Greater Bulldog bat also has prominent cheek pouches which are useful for holding its food.[6] Its hind legs and feet are particularly large.[5]

Distribution and variation

The greater bulldog bat's range streches from Mexico to northern Argentina and also includes most Caribbean islands.[6] While vast, its range is also patchy as the bat is limited to mostly well-watered lowland and coastal areas also well as river basins. There is geographical variation in the species and are classified as subspecies. Bats around the Caribbean Basin are large and usually have the pale mid-dorsal stripe, despite varying in pelage.[7] These bats are known as N. l. mastivus. In Guianas and the Amazon Basin, the bats are small and dark and often lack the pale mid-dorsal stripe.[7] These bats are known as N. l. leporinus. In eastern Bolivia, southern Brazil and northern Argentina bats tend to be large and pale, more so than the other subspecies.[7] They are known as N. l. rufescens.

Ecology and behavior

The greater bulldog bat lives primarily in tropical lowlands.[8] The bats are commonly found over ponds and streams as well as estuaries and coastal lagoons.[9] They live in colonies that number in the hundreds.[6] In Trinidad, bulldog bats roost in hollow trees like silk-cotton, red mangrove and balatá.[10] The bats live in hollow tree roosts in other areas as well.[6] They also roost in deep sea caves.[10] Like most bats, bulldog bats are nocturnal.

Female bulldog bats stay together in groups while roosting and tend to be accompanied by a resident male. Females associate with the same individuals in the same location for several years unaffected by changes in resident males and movements of the group to different roosts. A male may stay with a female group for two or more reproductive seasons. Bachelor males are segregated from the females and may roost alone or together in small groups. Female bats forage either alone or with their roost mates, with stable female groups continue to forage in the same areas in the long term. Males forage alone and use areas that are larger and separate from those used by the females.[11]

Food and hunting

The greater bulldog bat is one of the few bat species that has adapted to eating fish. Nevertheless, the bats eat both fish and insects. During the wet season, the bats feed primarily on insects like moths and beetles.[3] During the dry season, bat will primarily feed on fish as well as crabs, scorpions and shrimp to a lesser extent.[3] The bulldog bat mostly forages for fish during high tide and locates them with echolocation. A bulldog bat will fly high in the air and in a circular direction when searching for prey. If it spots a jumping fish, the bat will drop down to closer to the water surface, particularly the spot where it made the jump and decreases the pulse duration and intervals of its echolocation signals.[12] The bulldog bat may also search by dragging its feet across the water surface, a behavior known as raking.[12] The bat may rake through areas of with fish jumping is most frequent or in areas where it had previously made a successful catch.[12]

Echolocation

Greater bulldog bats emit echolocation signals that are either at constant frequency (CF), frequency-modulated (FM) or a combination of the two (CF-FM).[12] The longest signals are the pure CF signal which typically last 13.3 ms but can go as long as 17 ms.[12] CF-FM signals have CF followed by a FM. In an CF-FM signal, the CF are typically 8.9 ms with a frequency of 52.8–56.2 kHz while the FM ranges up to 3.9 ms with 25.9 kHz bandwidth.[12] Bulldog bats have two kinds of signal when flying. In one, the CF pulses begin at 60 kHz of frequency and may fall no further than 50 kHz.[6] The second type has the CF starting at a frequency of 60 kHz and then falls for more than a single octave.[6]

Reproduction cycle

For females, pregnancy occurs from September until January, and lactation starts in November and continues until April.[5] Only one young is born each gestation.[6] Male bats mostly breed autumn and winter.[6] Young bats stay in the roosts for one month and are then capable of flight.[6] Both the male and female care for the young.[6]

Status

While the bulldog bat is not in danger overall, the bat is nevertheless threatened by water pollution, persecution, changing water levels and deforestation.[1]

References

  1. ^ a b Barquez, R., Perez, S., Miller, B. & Diaz, M. 2008. Noctilio leporinus. In: IUCN 2010. IUCN Red List of Threatened Species. Database entry includes a brief justification of why this species is low risk.
  2. ^ Linnæus, Carl (1758). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin) (10 ed.). Holmiæ: Laurentius Salvius. p. 32. Retrieved 22 November 2012. 
  3. ^ a b c Brooke, A. (1994). "Diet of the Fishing Bat, Noctilio Leporinus (Chiroptera: Noctilionidae)". Journal of Mammalogy 75: 212–219. JSTOR 1382253. 
  4. ^ Eisenburg, J. (1989) Mammals of the Neotropics. University of Chicago Press.
  5. ^ a b c d e f Nowak, R. (1999) Bulldog Bats, or Fisherman Bats. Walker’s Mammals of the World. 6ed: 347–349.
  6. ^ a b c d e f g h i j k l Hood, C. S and Jones, J. K (1984). "Noctilio leporinus". Mammalian Species 216 (216): 1–7. doi:10.2307/3503809. 
  7. ^ a b c Davis, William B. (1973). "Geographic Variation in the Fishing Bat, Noctilio leporinus". Journal of Mammalogy 54 (4): 862–874. doi:10.2307/1379081. 
  8. ^ Larry C. Watkins, J. Knox Jones, Hugh H. Genoways, (1972) Bats of Jalisco Mexico, Museum of Texas Tech Univ, 1:1–44. ISBN 978-0-89672-026-8
  9. ^ Smith, J. D., Genoways, H. H. (1974). "Bats of Margarita Island, Venezuela, with zoogeographic comments". Bulletin of Southern California Academy of Sciences 73: 64–79. 
  10. ^ a b Goodwin, C.G. and Greenhall, A. (1961). "A review of the bats of Trinidad and Tobago". Bull. Am. Mus. Nat. Hist 122: 187–302. hdl:2246/1270. 
  11. ^ Brooke, A. May (1997). "Organization and Foraging Behaviour of the Fishing Bat, Noctilio leporinus (Chiroptera:Noctilionidae)". Ethology 103 (5): 421–436. doi:10.1111/j.1439-0310.1997.tb00157.x. 
  12. ^ a b c d e f Schnitzler, Hans-Ulrich; Kalko, Elisabeth K. V.; Kaipf, Ingrid and Grinnell, Alan D. (1994). "Fishing and Echolocation Behavior of the Greater Bulldog Bat, Noctilio leporinus, in the Field". Behavioral Ecology and Sociobiology 35 (5): 327–345. doi:10.1007/BF00184422. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!