You are viewing this Taxon as classified by:

Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Noctilo leporinus is found in tropical and subtropical parts of the New World from Southern Vera Cruz (Mexico) to Northern Argentina and Southeastern Brazil. This species is also found on the Greater and Lesser Antilles, and the Bahamas.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Sinaloa (Mexico) to the Guianas, Suriname, Brazil, Northern Argentina, Paraguay, Bolivia, Ecuador and Peru; Trinidad; Greater and Lesser Antilles; S Bahamas (Simmons 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The sexes are slightly dimorphic in size, the males averaging larger than the females. A male weighing 78 g, and a female weighing 60 g were reported by Klingener, Genoways, and Baker (1978). Head and body length is 98 to 132 mm, and forearm length measures 70 to 92 mm.

The sexes are also dimorphic in color, with males having reddish to orange pelage dorsally, and females generally having greyish or dull brown fur. Both males and females tend to have paler underparts, and the pelage is extremely short.

Noctilionids have a pointed muzzle and lack a nose leaf. The nose is somewhat tubular and projects slightly beyond the lips. Upper lips are smooth but divided by a "hare lip", a vertical fold of skin under the nostrils. The lips are also large and swollen in appearance, suggesting the common name, greater bulldog bat.

This bat presents a formidable dentition. Its cheeks are elastic and can be greatly expanded. Internal cheek pouches are present. The ears are large, slender, pointed, and separate. There is also a tragus which has a serrated margin.

Noctilio leporinus has wings which are long and quite narrow, being more than two and a half times the length of the head and body. Nearly 65% of the wingspan is composed of the third digit.

The tail is more than half as long as the thigh bone. It extends to about the middle of a well-developed uropatagium, or tail membrane. The tail tip is free, protruding for about 10 to 15 mm from the dorsal surface of this membrane. The uropatagium is supported by the legs, tail, and calcar, or heel extension. The calcar is a cartilaginous structure that articulates with the heel bone (calcaneum) and is unique to bats. In this fishing species, the calcar is large and serves to hold the uropatagium out of the water as the bat flies close to the surface.

Noctilio leporinus has unusually long hind limbs and very large hind feet with strong gaff-like claws. Fishing bats tend to have hind feet 1.8 to 3.9 times larger than related non-fishing bats.

Range mass: 60 to 78 g.

Range length: 98 to 132 mm.

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 0.4 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Southern Pacific Dry Forests Habitat

This taxon is found in the Southern Pacific dry forests ecoregion, which is situated along the southeastern versant of the Sierra Madre del Sur Mountains including the Pacific Ocean coastal plain. These forests are a key locus of endemism for butterflies, and has the greatest diversity of scorpions and spiders in the entirety of Mexico. This ecoregion is classified in the Tropical and Subtropical Dry Broadleaf Forests biome. The Southern Pacific dry forests exhibit a moderate to high faunal species richness; for example, there are a total of 744 vertebrate taxa recorded in the ecoregion, with a particularly large number of endemic reptiles.

The ecoregion elevation ranges from sea level to 1400 metres. The climate is tropical and dry, with precipitation levels of 800 millimetres (mm) per annum. There is an extended arid season, which factor drives the prevalence of deciduous vegetation. The forests grow chiefly on shallow, well-drained soils derived from limestone. Closer to the base of the Sierra Madre del Sur Mountains, the soils are more rocky, and are derived from igneous rocks.

The dominant plant species include Mauto (Lysiloma divaricatum), Bursera excelsa and Fragrant Bursera (B. fagaroides), which are typically found in association with Pochote (Ceiba aesculifolia), Comocladia engleriana, and Trichilia americana. In the Mexican state of Michoacán, the macro plant species more generally in evidence are Ficus insipida, F. pertusa, Breadnut (Brosimum alicastrum), Licania arborea, Sideroxylon capiri and Elephant Ear (Enterolobium cyclocarpum).

There are a number of anuran species present in the ecoregion, including: Blunt-toed Chirping Frog (Eleutherodactylus modestus VU); Cloud Forest Stream Frog (Ptychohyla euthysanota NT), found from southeast Oaxaca to Guatemala and eastern El Salvador; Matuda's Spikethumb Frog  (Plectrohyla matudai VU). A special status caecilian found in the ecoregion is the Mexican Caecilian (Dermophis mexicanus VU), a fossorial species that can attain lengths up to sixty centimetres. A special status salamander found in the ecoregion is the Sierra Juarez Salamander (Pseudoeurycea juarezi CR), a near-endemic known only between Cerro Pelón and Vista Hermosa in the Sierra de Juarez, north-central Oaxaca. The White-lipped Peeping Frog (Eleutherodactylus albolabris CR), a near-endemic known chiefly from Agua del Obispo, central Guerrero.

The Southern Pacific dry forests contain numerous reptilian taxa, including the following endemics: Bocourt's Anole (Norops baccatus); Taylor's Anole (Norops taylori), known only to  Puerto Marquez area, in northern Acapulco, Guerrero; Simmons' Anole (Anolis simmonsi), restricted to the vicinity of Pinotepa Nacional, Oaxaca; Stegneger's Blackcollar Spiny Lizard (Sceloporus stejnegeri), restricted to the Pacific versant in the state of Guerrero, Mexico; Red Earth Snake (Geophis russatus), found in a very narrow range outside of Putla, Oaxaca; Sierra Mije Earth Snake (Geophis anocularis), known only from around Totontepec on the Atlantic versant of the Sierra Mixe, Oaxaca; Ramirez`s Hooknose Snake (Ficimia ramirezi), restricted to the Pacific versant of the Isthmus of Tehuantepec, Niltepec, Oaxaca; Halberg's Cloud Forest Snake (Cryophis hallbergi), found only in northern Oaxaca, at Sierra de Juarez and Sierra Mazateca; Isthmian Earth Snake (Geophis isthmicus), known only from the vicinity of Tehuantepec, Mexico; the endemic Macdougall's Spiny Lizard (Sceloporus macdougalli).

Characteristic mammalian fauna include the endemic Oaxacan Pocket Gopher (Orthogeomys cuniculus), restricted to several sites on the Isthmus of Tehuantepec, Oaxaca. Other mammals seen in the ecoregion include the: Lesser Long-nosed Bat (Leptonycteris yerbabuenae VU), Tropical Hare (Lepus flavigularis EN), restricted to Salina Cruz, Oaxaca to the extreme west of  Chiapas; Greater Bulldog Bat (Noctilio leporinus), Coati (Nasua narica), Buller’s Pocket Gopher (Pappogeomys bulleri), Javelina (Tayassu tajacu), and Mexican Long-tongued Bat (Choeronycteris mexicana NT).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

They roost near streams, coastal marine habitats, major river basins, or other moist places.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Hollow trees, caves, piscivore, can eat aquatic insects. Observed in groups larger than 30 individuals in Brazil (Barquez 1999). They roost near streams, coastal marine habitats, major river basins, or other moist places. Bachelor males roost apart from females. Males residing with female groups stay for two or more reproductive seasons (Mulheisen and Berry 2000). Females bear a single young each pregnancy. This species tends to have pregnancies occuring from September until January, and lactation is first seen in November and continues until April. This is a general pattern, however, and it can vary with geographical location. Reproduction corresponds to seasons of greatest food availability (Mulheisen and Berry 2000).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Noctilio leporinus catches and consumes fish. It is one of about six bat species that regularly eat fish. It will also eat aquatic crustaceans, stinkbugs, crickets, scarab beetles, moths, winged ants, and other insects, but primarily, it is a piscivore (fish-eater).

Animal Foods: fish; insects; terrestrial non-insect arthropods; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
11.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.8 years (captivity) Observations: Two wild-caught animals lived about 11.8 years at Bronx Zoo (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Bachelor males roost apart from females. Males residing with female groups stay for two or more reproductive seasons. Female N. leporinus bear a single young each pregnancy. This appears to form the basis of a polygynous social organization.

This species tends to have pregnancies occuring from September until January, and lactation is first seen in November and continues until April. This is a general pattern, however, and it can vary with geographical location. Reproduction corresponds to seasons of greatest food availability.

Young bats don't leave the roost for their first attempts at sustained flight until nearly adult size. At that time they are slightly less than one month of age and the parents have remained at the roost throughout. This suggests a high degree of bi-parental care which may be a characteristic of this species.

Breeding interval: These bats apparently breed once per year.

Breeding season: Pregnancies occur from September until January, although the time of mating is apparently unreported in the literature.

Range number of offspring: 1 to 1.

Average gestation period: 2 months.

Average time to independence: 1 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Noctilio leporinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNTATTTACTATTCGGTGCCTGAGCCGGAATAGTAGGAACCGCCCTAAGCCTAATCATCCGAGCAGAATTAGGTCAACCAGGCACTTTGCTTGGTGATGACCAAATTTATAATGTCGTAGTAACAGCCCACGCTTTCGTAATAATTTTCTTTATAGTAATACCTATTATAATCGGAGGGTTTGGCAATTGATTAGTTCCATTAATAATTGGGGCACCAGACATGGCCTTCCCTCGAATAAATAATATAAGCTTTTGACTACTCCCCCCATCTTTCCTATTACTACTAGCCTCCTCAATAGTTGAAGCCGGGGCAGGGACCGGATGAACCGTCTACCCTCCTTTAGCAGGCAACTTAGCCCACGCCGGAGCTTCAGTAGATCTTGCAATTTTCTCTCTTCACCTAGCAGGGGTCTCATCCATTCTTGGCGCTATTAATTTCATTACAACTATTATTAATATAAAACCCCCAGCTCTCTCCCAATATCAAACTCCCCTATTCGTATGATCAGTACTAATTACAGCCGTTCTACTTTTACTGTCCCTTCCTGTGCTAGCTGCGGGCATCACTATACTACTAACAGACCGAAACCTAAATACCACTTTCTTTGACCCTTGTGGAGGAGGAGATCCAATTCTTTATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Noctilio leporinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 33
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

These bats have no special conservation status. However, one report on the island of Curacao, Netherlands Antilles, showed that uncontrolled cave disturbance and removal of resources through development has brought about an apparent decrease in bat numbers.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Perez, S., Miller, B. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant. Rare in Argentina (Barquez pers. comm.). Large roosts of hundreds of bats have been reported. They may also roost in smaller groups of up to 30 individuals and forage at night in groups of 5 to 15 animals (Mulheisen and Berry 2000).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats throughout its range. In Guatemala fishfarmers are killing this species (Cajas pers. comm.). Water bodies pollution (Armando Rodriguez pers. comm.). In Belize the water level changed and restricted the range (Miller pers. comm.). Deforestation (Uribe and Castro-Arellano, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Found in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Groups of Noctilio leporinus may take significant numbers of small fish from hatcheries and aquaculture projects. Methods for blocking echolocation over hatchery ponds can be effective in preventing these losses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greater bulldog bat

The greater bulldog bat or fisherman bat (Noctilio leporinus) is a type of fishing bat native to Latin America (Spanish: Murciélago pescador). The bat uses echolocation to detect water ripples made by the fish upon which it preys, then uses the pouch between its legs to scoop the fish up and its sharp claws to catch and cling to it. It is not to be confused with the lesser bulldog bat, which, though belonging to the same genus, merely catches water insects, such as water striders and water beetles.

It emits echolocation sounds through the mouth like Myotis daubentoni, but the sounds are quite different, containing a long constant frequency part around 55 kHz, which is an unusually high frequency for a bat this large.

General description[edit]

The greater bulldog bat is a large bat, often with a combined body and head length of 10.9 to 12.7 cm (4.6 to 5 in). It generally weighs from 50–90 grams.[3] Males tend to be larger than females, with the former averaging 67 grams and the latter averaging 56 grams.[4] They also differ in fur color. Males have bright orange fur on the back while females are dull gray.[5] However, both sexes have pale undersides and may have a pale line that runs down the middle of the back.[5] The bulldog bat has rounded nostrils that open forward and down. It has elongated, pointed ears with a tragus that gets ridged at the outer edge. The bulldog bat has smooth lips but its upper lip is divided by a skin fold while its bottom lip has a wart above skin folds that extend to the chin.[5] It is these features that give the bulldog bat gets its name, as it resembles a bulldog.

The bulldog bat has a wingspan of 1 meter (3 feet). The wing of the bat is longer than the head and body combined and 65% of its wingspan is made of the third digit.[6] When in flight, the bat's wings move slowly.[6] This species is a capable swimmer and will use its wings to paddle.[5] The Greater Bulldog bat also has prominent cheek pouches which are useful for holding its food.[6] Its hind legs and feet are particularly large.[5]

Distribution and variation[edit]

The greater bulldog bat's range stretches from Mexico to northern Argentina and also includes most Caribbean islands.[6] While vast, its range is also patchy as the bat is limited to mostly well-watered lowland and coastal areas also well as river basins. There is geographical variation in the species and are classified as subspecies. Bats around the Caribbean Basin are large and usually have the pale mid-dorsal stripe, despite varying in pelage.[7] These bats are known as N. l. mastivus. In Guianas and the Amazon Basin, the bats are small and dark and often lack the pale mid-dorsal stripe.[7] These bats are known as N. l. leporinus. In eastern Bolivia, southern Brazil and northern Argentina bats tend to be large and pale, more so than the other subspecies.[7] They are known as N. l. rufescens.

Ecology and behavior[edit]

The greater bulldog bat lives primarily in tropical lowlands.[8] The bats are commonly found over ponds and streams as well as estuaries and coastal lagoons.[9] They live in colonies that number in the hundreds.[6] In Trinidad, bulldog bats roost in hollow trees like silk-cotton, red mangrove and balatá.[10] The bats live in hollow tree roosts in other areas as well.[6] They also roost in deep sea caves.[10] Like most bats, bulldog bats are nocturnal.

Female bulldog bats stay together in groups while roosting and tend to be accompanied by a resident male. Females associate with the same individuals in the same location for several years unaffected by changes in resident males and movements of the group to different roosts. A male may stay with a female group for two or more reproductive seasons. Bachelor males are segregated from the females and may roost alone or together in small groups. Female bats forage either alone or with their roost mates, with stable female groups continue to forage in the same areas in the long term. Males forage alone and use areas that are larger and separate from those used by the females.[11]

Food and hunting[edit]

The greater bulldog bat is one of the few bat species that has adapted to eating fish. Nevertheless, the bats eat both fish and insects. During the wet season, the bats feed primarily on insects like moths and beetles.[3] During the dry season, bat will primarily feed on fish as well as crabs, scorpions and shrimp to a lesser extent.[3] The bulldog bat mostly forages for fish during high tide and locates them with echolocation. A bulldog bat will fly high in the air and in a circular direction when searching for prey. If it spots a jumping fish, the bat will drop down to closer to the water surface, particularly the spot where it made the jump and decreases the pulse duration and intervals of its echolocation signals.[12] The bulldog bat may also search by dragging its feet across the water surface, a behavior known as raking.[12] The bat may rake through areas of with fish jumping is most frequent or in areas where it had previously made a successful catch.[12]

Echolocation[edit]

Greater bulldog bats emit echolocation signals that are either at constant frequency (CF), frequency-modulated (FM) or a combination of the two (CF-FM).[12] The longest signals are the pure CF signal which typically last 13.3 ms but can go as long as 17 ms.[12] CF-FM signals have CF followed by a FM. In an CF-FM signal, the CF are typically 8.9 ms with a frequency of 52.8–56.2 kHz while the FM ranges up to 3.9 ms with 25.9 kHz bandwidth.[12] Bulldog bats have two kinds of signal when flying. In one, the CF pulses begin at 60 kHz of frequency and may fall no further than 50 kHz.[6] The second type has the CF starting at a frequency of 60 kHz and then falls for more than a single octave.[6]

Reproduction cycle[edit]

For females, pregnancy occurs from September until January, and lactation starts in November and continues until April.[5] Only one young is born each gestation.[6] Male bats mostly breed autumn and winter.[6] Young bats stay in the roosts for one month and are then capable of flight.[6] Both the male and female care for the young.[6]

Status[edit]

While the bulldog bat is not in danger overall, the bat is nevertheless threatened by water pollution, persecution, changing water levels and deforestation.[1]

References[edit]

  1. ^ a b Barquez, R., Perez, S., Miller, B. & Diaz, M. 2008. Noctilio leporinus. In: IUCN 2010. IUCN Red List of Threatened Species. Database entry includes a brief justification of why this species is low risk.
  2. ^ Linnæus, Carl (1758). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin) (10 ed.). Holmiæ: Laurentius Salvius. p. 32. Retrieved 22 November 2012. 
  3. ^ a b c Brooke, A. (1994). "Diet of the Fishing Bat, Noctilio Leporinus (Chiroptera: Noctilionidae)". Journal of Mammalogy 75: 212–219. JSTOR 1382253. 
  4. ^ Eisenburg, J. (1989) Mammals of the Neotropics. University of Chicago Press.
  5. ^ a b c d e f Nowak, R. (1999) Bulldog Bats, or Fisherman Bats. Walker’s Mammals of the World. 6ed: 347–349.
  6. ^ a b c d e f g h i j k l Hood, C. S and Jones, J. K (1984). "Noctilio leporinus". Mammalian Species 216 (216): 1–7. doi:10.2307/3503809. 
  7. ^ a b c Davis, William B. (1973). "Geographic Variation in the Fishing Bat, Noctilio leporinus". Journal of Mammalogy 54 (4): 862–874. doi:10.2307/1379081. 
  8. ^ Larry C. Watkins, J. Knox Jones, Hugh H. Genoways, (1972) Bats of Jalisco Mexico, Museum of Texas Tech Univ, 1:1–44. ISBN 978-0-89672-026-8
  9. ^ Smith, J. D., Genoways, H. H. (1974). "Bats of Margarita Island, Venezuela, with zoogeographic comments". Bulletin of Southern California Academy of Sciences 73: 64–79. 
  10. ^ a b Goodwin, C.G. and Greenhall, A. (1961). "A review of the bats of Trinidad and Tobago". Bull. Am. Mus. Nat. Hist 122: 187–302. hdl:2246/1270. 
  11. ^ Brooke, A. May (1997). "Organization and Foraging Behaviour of the Fishing Bat, Noctilio leporinus (Chiroptera:Noctilionidae)". Ethology 103 (5): 421–436. doi:10.1111/j.1439-0310.1997.tb00157.x. 
  12. ^ a b c d e f Schnitzler, Hans-Ulrich; Kalko, Elisabeth K. V.; Kaipf, Ingrid and Grinnell, Alan D. (1994). "Fishing and Echolocation Behavior of the Greater Bulldog Bat, Noctilio leporinus, in the Field". Behavioral Ecology and Sociobiology 35 (5): 327–345. doi:10.1007/BF00184422. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!