Articles on this page are available in 1 other language: Chinese (Simplified) (1) (learn more)

Overview

Distribution

Range Description

This species is known from southern Siberia (Russia), Mongolia, the Korean Peninsula, central and eastern China including Taiwan, and Japan. In Japan, it is found on Hokkaido, Honshu, Shikoku, and Kyushu. In Mongolia it has been recorded in steppe habitats in Eastern Mongolia (Stubbe and Chotolchu, 1968; Sokolov and Orlov, 1980), including Herlen and Halh rivers, and close to Buir Lake (Bannikov, 1954; Sokolov and Orlov, 1980). In China it is widepread across many provinces.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species roosts in tree hollows of large trees, as well as in houses and caves along the seashore (Abe et al., 2005). They also inhabit steppe as well as mountainous regions, semi-desert and desert regions, roosting in colonies in buildings or rocky areas (Sokolov and Orlov, 1980), and feed around water sources or swampy sites. Starts feeding at early dusk and prey flying insects quite high, usually at open spaces.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vespertilio sinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTTTATTTATTATTTGGTGCCTGAGCTGGCATAGTGGGAACCGCACTAAGCCTCTTGATCCGAGCTGAGTTAGGCCAGCCAGGAGCTTTACTTGGAGATGATCAGATTTACAACGTAATTGTAACCGCCCACGCTTTTGTAATAATTTTCTTTATAGTTATGCCTATTATAATTGGGGGCTTTGGGAATTGACTCGTTCCACTGATAATTGGAGCCCCCGATATAGCATTCCCCCGAATAAATAATATAAGTTTCTGGCTCCTTCCCCCTTCTTTCCTATTACTCCTGGCCTCATCTATAGTAGAAGCGGGGGCCGGTACGGGTTGAACAGTATATCCCCCCTTAGCGGGAAATTTAGCCCATGCAGGAGCCTCCGTAGACTTAACTATTTTCTCTCTTCATCTGGCAGGGGTATCTTCAATCTTAGGTGCTATTAATTTTATTACTACAATTATTAATATAAAACCCCCTGCCCTCTCCCAATATCAAACCCCACTTTTTGTCTGATCAGTCCTTATTACAGCCGTTCTTCTCCTATTATCTCTTCCCGTATTAGCTGCTGGTATTACAATACTATTAACAGACCGAAACTTGAATACGACTTTCTTTGACCCAGCTGGAGGGGGAGATCCTATTTTATATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vespertilio sinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Stubbe, M., Samiya, R., Ariunbold, J., Buuveibaatar, V., Dorjderem, S., Monkhzul, Ts., Otgonbaatar, M. & Tsogbadrakh, M.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Tsytsulina, K. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern, because it is widespread, adaptable, and there are no known major threats throughout its range. In Japan listed as Vulnerable or Data Deficient.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Mongolia there is no population information available, but colonies have been observed in a variety of places. One colony was found under a concrete bridge near Choibalsam over the Kherlen River (S. Dorjderem pers. comm.). Another breeding colony was found in a house by the Mongolian-Chinese border, at a military point called Erdentsagaan. In Russia nursery colonies up to several dozen or hundreds females are known.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species throughout its range. It is commonly found around human settlements, therefore accidental mortality (accidental trapping, poisoning, and roost destruction) probably occur but this is not considered a major threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in several protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Asian particolored bat

The Asian parti-colored bat (Vespertilio sinensis) is a species of bat. An adult Asian parti-colored bat has a body length of 6-7 cm, a tail of 4.3-4.5 cm, and a wing length of 5 cm. Asian parti-colored bats are distributed across East Asia, from Taiwan through eastern China, eastern Mongolia and Russia (Siberia) to the Korean Peninsula and Japan (Hokkaido, Honshu, Shikoku, and Kyushu).

References

Notes
Sources
  • Won, Byeong-o (원병오) (2004). 한국의 포유동물 (Hangugui poyudongmul, Mammals of Korea). Seoul: Dongbang Media. ISBN 978-89-8457-310-9.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!