Overview

Brief Summary

Biology

Elephant society is highly complex and arranged around family units composed of groups of closely related females and their calves. Each family unit contains around ten individuals (6), led by an old female known as the 'matriarch' (2). Family units often join up with other bands of females forming 'kinship groups' or 'bond groups', and larger herds may number well over a hundred individuals (7). Male elephants leave their natal group at puberty and tend to form much more fluid alliances with other males. Elephants are extremely long-lived and although females may reach sexual maturity at ten years old they are at their most fertile between 25 and 45 (2). There is no distinct breeding season, although birth peaks in certain areas may relate to the local rainfall patterns (9). Calves are born after an exceptionally long gestation period of nearly two years, and continue to be dependent on their mother for several years (2). They are also cared for by other females in the group, especially by young females known as 'allomothers' (2). The social bonds between elephants are very strong and if faced with danger they will form a protective circle around the young calves, with the adults facing outwards and the matriarch adopting a threatening pose or even charging the intruder (2). Elephants care for their wounded and also show recognition of, and particular interest in, elephant bones (10). Elephant groups will spend the day wandering their home range in search of food and water (2). An adult elephant requires 160 kilograms of food a day; using their highly mobile trunk they pluck at grasses and leaves or tear at branches and bark with their tusks, which can cause enormous damage (7). Elephants can communicate over large distances and use some vocalisations that are below the range of human hearing (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Introduction

Loxodonta africana, the African elephant, is currently found in Africa, south of the Sahara, occuring in about 35 African states.Elephants are faced with a dual threat to their survival
  • destruction of their habitat
  • hunting
The former is common to many other species, the latter is due to the elephant’s possession of a precious commodity - ivory.There is currently a massive surge in ivory trading. More than 14,000 products made from the tusks and other body parts of elephants were seized in 2009. It is estimated that between 8% and 10% of Africa’s elephants are now being killed each year to meet the demand, mostly from the Far East. With the current world population of African elephant at around 300,000-400,000, this represents an annual take of up to 40,000 animals and is clearly not sustainable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

One of the most emotive of the megafauna and the largest living terrestrial animal, African savanna elephants inspire awe at their sheer size; the largest recorded individual reached a massive four metres at the shoulder and weighed ten tonnes (2). The thickset body rests on stocky legs and the back has a characteristically concave shape (2). African elephants have large ears to enable heat loss (6). Their upper lip and nose is elongated into a trunk that serves multiple functions, from a dextrous fifth limb to a sound producer and amplifier, and an important method of touch between individuals (2). The African elephant trunk ends in two opposing processes (or lips), which differs from that of the Asian elephant (Elephas maximus), whose trunk ends in a single process (7). A further characteristic feature are the elephant's tusks, which are large modified upper incisors that continue to grow throughout their lifetime; in both sexes of the African elephant these are curved forward (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Reproduction
Elephant reproduction is slow; a female gives birth only every four or five years:
  • Usually to one calf at a time
  • Twinning occurs in roughly one in 100 births
  • Birth weight is around 120kg
Growth to adulthood is also a long process. In consequence, a tremendous amount of time and energy is expended in the rearing of the young, a task that falls entirely to the females.Elephant cows become sexually mature at the age of 12-14, and begin to reproduce soon after that date. Bulls start producing sperm around the same time, but in practice rarely father any calves until they are approaching 30.Female elephants come into oestrus about every 16 weeks and are sexually receptive for only a day or so during this period, so male and female behaviour must be tightly attuned. A male, especially when in musth, will visit female groups, searching for oestrus females by touching their vulvas with the tip of his trunk. He then touches his trunk tip on a specialised taste gland, the Jacobson’s organ, on the roof of his mouth. It has recently been discovered that the females’ urine contains a pheromone indicating that she is in oestrus. She will also signal her readiness by behavioural cues. Copulation begins as the male reaches over the female’s shoulder with his trunk from behind. The female exerts some choice in the matter and may run off even at this stage. Otherwise, the bull mounts her, placing most of his weight on his back legs. The penis is S-shaped, up to 1 m long, and highly muscular, finding and entering the vulva without pelvic movement. The testes are internal (unusual in mammals) and situated near the kidneys; up to a litre of ejaculate is produced. The bull may remain with the female for anything from a few hours to a few days, mating with her occasionally and guarding her from the advances of rival males.

Pregnacy
Pregnancy lasts about 22 months, and birth, accomplished with the mother squatting or lying, is assisted by other females of the group. The two mammary glands are situated between the front legs (unusual for quadrupedal mammals). Calves suckle until the second or third year or even longer, depending on when the next calf is born. Male calves suckle more frequently than females and, after the first few years, the difference in size between them becomes apparent. Female calves will remain in their family unit for life, eventually taking over its leadership, while males leave at sexual maturity, often aided by increasing impatience of the mother.In drought years, cows are unlikely to come into oestrus, naturally regulating their reproduction. Otherwise, they can conceive at any time of year, but in seasonal environments, a definite peak has been observed some weeks after the onset of the rains. With a 22-month gestation, this ensures that the calf will be born when rainy-season greening has begun two years later, providing the mother with a rich food supply for lactation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

African Elephants are the heaviest land mammals, with males somewhat larger than females. They have enormous ears, and a unique nose that extends from the upper lip as a long, boneless trunk. The elephant’s incisor teeth develop into tusks that can weigh about 60 kg (130 lbs) each.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

African Elephants currently occur in 37 countries in sub-Saharan Africa (see accompanying map, sourced from Blanc et al. 2007). They are known to have become nationally extinct in Burundi in the 1970s, in The Gambia in 1913, in Mauritania in the 1980s, and in Swaziland in 1920, where they were reintroduced in the 1980s and 1990s.

Although large tracts of continuous elephant range remain in parts of Central, Eastern and Southern Africa, elephant distribution is becoming increasingly fragmented across the continent.

The quality of knowledge available on elephant distribution varies considerably across the species' range. While distribution patterns are well understood in most of Eastern, Southern and West Africa, there is little reliable information on elephant distribution for much of Central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

African elephants were historically found south of the Sahara Desert to the south tip of Africa, from the Atlantic (western) coast of Africa to the Indian Ocean in the east. Currently populations are found in increasingly fragmented habitat throughout the same range, often primarily in and near wildlife reserves and protected areas due to poaching and habitat destruction.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution habitat



Distribution
The current range of the African elephant is Africa, south of the Sahara. It occurs in about 35 African states.The species formerly extended into North Africa up to the Mediterranean coast. In West Africa, only thinly scattered, small populations remain. Central African rainforests still harbour substantial, largely continuous populations of L. a. cyclotis.Savannah elephants, L. a. africana, occur in East and southern African savannas down to northernmost Namibia, Botswana, Zimbabwe and South Africa (with a large gap in central Angola and neighbouring areas).

Habitat
Although occupying exclusively tropical and subtropical zones, African elephants live in a wide range of habitats, including:
  • Evergreen forests
  • Dry deciduous forests
  • Savannas (mixed woodland and grassland mosaics)
  • Semi-deserts
They are essentially mixed feeders, so accessibility to a wide range of plants, and to water within one day’s walk, are essential prerequisites.Estimates of natural animal density are hard to make. The carrying capacity will also vary enormously with the environment. In general, an area of about 2 mi2 (5 km2) per animal is probably typical in the wild, although the figure may be as high as 7.7 mi2 (20 km2) in rainforest habitats.In many areas where they live, elephants are the dominant mammalian species in terms of biomass, and have a major ecological role. Their massive dung production recycles nutrients back into the soil. They can disperse seeds and fruits over wide distances,

Are elephants changing their own environment?
Elephants’ habit of destroying trees has led to debate about their role in changing their own environment. In some parts of Africa, elephants have transformed wooded areas into open grassland. However it us likely that, originally, such phenomena formed part of a natural cycle, with long-term balance between different habitats.If a high number of elephants in one area caused a reduction in the tree density, either the elephant population would limit its own reproduction, or the animals would migrate to another area, allowing regeneration of woodland. In some areas even today, vegetation regeneration seems to keep pace with elephant feeding; it is primarily in savanna habitats, and particularly where elephants have been constrained within the boundaries of reserves, that problems arise, and in the present situation these are certainly important issues for conservation.Many other factors, such as fire and climate change, also contribute to the balance between elephants and their habitats. In the severe drought of 1970-71, thousands of elephants died in Africa as a result of food and water shortage.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Africa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The savanna elephant occurs largely in Eastern, Southern and West Africa (8), although populations are increasingly fragmented (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

African elephants are the heaviest land animal, and the second tallest in the Animal Kingdom. They are a sexually dimorphic species; males appear larger than females. The height of a bull at his shoulder is about twelve feet (about 3.75 m), when the female’s height is nine feet (about 3 m). They have enormous ears, each measuring about four feet (120-125 cm) across. They have a unique nose that is simply a long, boneless trunk extending from the upper lip. The trunk usually measures about five feet long (about 150 cm) and weighs around 300 pounds (about 135 kg). The two finger-like projections on the tip are so dexterous they can pick a blade of grass. The trunk itself is so strong it is capable of lifting 600 pounds (250- 275 kg). Their incisor teeth develop into tusks about 8 feet long (245-250 cm) and can weigh about 130 pounds (60 kg) each. The only other teeth they have are four molars which are replaced three times throughout their lives after the previous set wears down. African elephants have dark gray skin which is scattered with black hairs that wear off through the years. As a result the adults are mostly hairless. Their skin is about 2 1/2 inches (2-4 cm) thick, but flies, mosquitoes and parasites still penetrate it. There are two currently recognized subspecies which differ in their geographic location, tusk length, and weight. Forest elephants, Loxodonta africana cyclotis, typically reside in rain forests. They have more slender tusks and are smaller in height and weight than savannah/desert elephants (Loxodonta africana africana) who usually are found in grasslands.

(Estes, 1999; CITES, 2001; Moss, 1992)

Range mass: 3600 to 6000 kg.

Average mass: 4540.00 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Loxodonta africana
Catalog Number: USNM A22247
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Tooth or Tusk
Collector(s): Collector Unknown
Locality: Locality Unknown
  • Type: Lydekker, R. 1907 Apr 23. Proceedings of the Zoological Society of London. 1907 (1): 399.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The African Elephant is very catholic in its range, and tends to move between a variety of habitats. It is found in dense forest, open and closed savanna, grassland and, at considerably lower densities, in the arid deserts of Namibia and Mali. They are also found over wide altitudinal and latitudinal ranges – from mountain slopes to oceanic beaches, and from the northern tropics to the southern temperate zone (approximately between 16.5° North and 34° South). See also the list of habitats.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The habitats occupied by African elephants vary because they can survive long periods of time without water; they occupy deserts, forests, savannas, river valleys and marshes.

(CITES, 2001)

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest

Wetlands: marsh ; swamp

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are two subspecies of the African Elephant. The forest elephant is smaller and lives in rainforests, the savanna elephant in more open habitats. Historically found throughout sub-Saharan Africa, elephants are currently found in increasingly fragmented habitat throughout the same range.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The savanna elephant is found in a wide variety of habitats, such as forests, mopane and miombo woodlands, Sahelian scrub, and even deserts (for example, in Namibia and Mali) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Elephants eat vegetation like leaves, roots, bark, grasses and fruit. Each day they can consume anywhere from 220 to 660 pounds (100 to 300 kg) of food, and drink up to 50 gallons (190 L) of water. During the rainy seasons elephants eat grass and herbs like papyrus (Cyperus papyrus) and cat tails (Typha augustifolia). During dry seasons in the savannah they eat leaves collected from thorny trees and bushes. Swamps are a last resort for food because swamp vegetation contains little nutrition. However, dying elephants are often found in these areas because this vegetation is softer and older elephants are often missing teeth.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; fruit

Primary Diet: herbivore (Folivore , Frugivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Very few species can alter its own environment like elephants do. They demolish bushes, pull up trees by their roots and pack down the soil which can lead to erosion. This destruction also turns wooded areas into grasslands that are needed by grazing animals. Elephants create water holes by digging in dry riverbeds. They coat themselves with mud from the waters edge to protect from the sun and parasites, which creates a larger water hole. They can make and enlarge caves by searching for salts to eat. These caves are used for shelter for many different species. When elephants walk they stir up insects for birds to eat and easily disperse seeds which pass through their system undigested. The African Eggplant (Solanum aethiopicum) only grows after it has been through their system and fertilized by the elephant dung.

Ecosystem Impact: disperses seeds; keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The size of adult elephants leaves them invulnerable to wild animals. Humans are the only predators to adult elephants but calves are susceptible to be snatched away by lions and hyenas. If they sense a predator nearby, the largest cows instinctively herd the calves into a bunch around the matriarch. Next, they form circles around the cluster which creates protective layers that are impossible for predators to penetrate.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Loxodonta africana is prey of:
Homo sapiens
Panthera leo
Hyaeninae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Feeding diet

Food
Elephants consume a huge range of plant types, including grasses, herbs, shrubs, broadleaved trees, palms, and vines. Depending on the plant, they can take every conceivable part, including leaves, shoots, twigs, branches, bark, flowers, fruit, pods, roots, tubers and bulbs. The range of plants taken by an individual elephant can be anything between 100-500 species, although in a given time and place the animals may concentrate on a few species.

Seasonal
Patterns of consumption change with the seasons. In the savanna-woodland habitats of Africa, new-growth grasses are favoured in the rainy season, comprising 50-60% of the diet, but as these become tough in the dry season, the elephants switch to browse, so that the leaves and fruit of trees and shrubs now comprise 70% of the intake. For elephants in the rainforest habitats of Central Africa, the year-round supply of succulent leaves and fruits ensures that grass plays a lesser part in their diet.

Amount
Food consumption is 100-300 kg per day. Elephants spend 12-18 hours per day eating, most intensively in the morning and in the late afternoon to evening. In food-rich forest areas, elephants will typically move slowly through the day, browsing on a variety of plants, and eventually covering several kilometres. In many areas, there are daily rhythms: where both woodland and open grassland are available, for example, the elephants may spend the morning and early afternoon browsing in the woodland, emerging in the cool of the late afternoon to graze. Fluid consumption can be 200 litres of water per day in hot weather. When water is scarce, elephants will dig holes in dry stream or lake beds, using their feet, trunk, and tusks, until water seeps in and can be sucked up.

Area
When plants become ready at particular times of year, such as fruits or new shoots, elephants will gravitate towards them, using both smell and a memory from past years. Generally speaking, the poorer the quality, abundance, or predictability of food and water, the greater the distances elephants must travel to find it. Home ranges, measured by radio-collaring individuals, can be as high as 3000 km2 in the Namib desert, where individuals can easily walk 80 km in a day. In many areas, migrations are seasonal. Where water is a key issue, elephants tend to accumulate in the dry season in areas where it can be found, dispersing more widely when this constraint is lifted during the wet season.

Trunk
Small items can be plucked or picked up with the terminal ‘fingers’ of the trunk; larger items, such as branches, by curling the trunk around them and pulling or twisting. Elephants are highly inventive and can be seen, for example, kicking up sods of dry turf with their feet, picking up the resulting grassy clump with the trunk, banging it against their leg to shake off the earth, and putting it in their mouth. To reach high branches where young, succulent leaves are to be found, or high in acacia trees, where there are fewer thorns, they can rear up on their back legs, giving a total reach of up to 8 m. They will also uproot or push over trees. Finally, the trunk is important in drinking; water is not sucked all the way up into the nose like a drinking straw, but is sucked into the lower part of the trunk, then the trunk is arched and water squirted into the mouth. The only time in its life when an elephant feeds directly with its mouth is when suckling, the mouth being pressed directly against the breast with the trunk curled up out of the way.

Tusks
The tusks are used to strip bark from trees, which is then eaten; to dig for roots or for water in the dry season; and to scrape or hack salt and other minerals from the soil or exposed rock.

Teeth
The molar teeth display a series of long, thin, enamel ridges running side-by-side; for this reason, an elephant chews by swinging its lower jaw fore and aft, so that the enamel ridges on the upper and lower teeth cut past each other, shearing the food. The tremendous wear caused by feeding long hours every day on abrasive food causes the teeth to grind down to the root, and elephants not only have high-crowned teeth, but replace their teeth five times through their life, making six sets in all. Each set, however, comprises only four massive molars: lower and upper, left and right. As one tooth wears out it moves forward in the jaw and is gradually replaced by another from behind.

Digestion
The majority of an elephant’s digestion is accomplished with the aid of cellulose-digesting micro-organisms inhabiting its large intestine, especially a large blind sac opening from it, the caecum. This is a relatively inefficient method of digestion – only 40% or so of food, by weight, is utilised – but it does allow the animal to process large quantities of relatively low-nutrient food. The intestine is up to 35 m long and may weigh up to a tonne when full of food, releasing an average of 100 kg of dung per day.Elephants seem quite resistant to the tannins present in, for example, acacia bark and, by consuming a wide variety of species, they limit the intake of toxic defensive compounds specific to particular plant types. Tree bark is eaten because it provides essential minerals and fatty acids, as well as roughage. Elephants also frequent salt licks, those patches of soil or exposed rock high in minerals such as sodium.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

The understanding of the complex social lives of African elephants has been built up thanks to long-term studies over 20 or 30 years by dedicated field researchers, notably Cynthia Moss and colleagues in East Africa. By learning to recognise individual animals, much has been learned about social organization and the factors influencing the status and success of families and individuals.

Society
Elephant society has a structure that has been termed matriarchal. The core element is the family unit, a group of 3-25 individuals, comprising related adult females and their young. Females within the family unit are closely bonded for life. By contrast, adult males tent to be solitary, or may form temporary associations of two or three unrelated bulls. They leave the family of their birth at 12-15 years of age and, after that time, although they may frequently associate with female groups for feeding or mating, they have no long term bonds with them, or with each other.Elephants are highly intelligent animals with a complex repertoire of social interactions. Within the family group, individuals of all ages greet, and maintain bonding, by touching their trunk tips to each other’s bodies, rubbing together, and with sound communication and scent. In calves, play is a dominant behaviour. They mock charge, chase each other or wrestle with their trunks. Males, from an early age, engage in mock sparring matches. They are also more independent of their mothers than females, a trend that increases as they get older.

Female groups
Within the female groups, a few older individuals, and in particular the lead individual, termed the matriarch, are instrumental in deciding the group’s pattern of movement, in defending the group against danger, and in monitoring and responding to other approaching elephants. Calves, especially when very young, stay close to their mother, but all females in the group will aid with in their upbringing. At the approach of a predator, adult females wheel round to face the source of danger, protecting the calves that stay close behind. The members of the family unit may separate for short intervals during the day, but will soon regroup. Family units also form looser associations or “bond groups”, with more distantly related families. Occasionally, very large herds if 500 or even 1,000 elephants can be seen, primarily during migration. Even then, within the mass of animals, individual family groups maintain their integrity.

Males
There is a dominance hierarchy among bulls, generally related to their age, size, and power. If two bulls of roughly equal size meet, they assess each other through intertwining trunks, pushing and pulling, or lightly engaging their tusks. Rarely, sparring may lead to a full-scale fight, sometimes (but not always) for access to an oestrus female. The combatants will charge each other with ears outstretched, or cross tusks and attempt to twist each other off-balance, all accompanied by loud vocalisations. Each tries ultimately to gore the other with his tusks, sometimes resulting in fatal wounds by deep penetration of the head or chest. Broken tusks may result from twisting with the full body weight. The fight will end either by withdrawal of the weaker animal, or with death.Male elephants enter a periodic state called ‘musth’. The temporal gland, located on the side of the head between the ear and the eye, produces a dark fluid (temporin) with a strong musky odour. Musth males also intermittently dribble urine. A male elephant generally enters musth once a year, for a period of anything up to a month, the time of year varying with the animal. Musth bulls have heightened levels of testosterone and are very aggressive, especially toward other bulls. Musth is associated with heightened sexual activity, although non-musth bulls also mate. Females also have a temporal gland, which can occasionally be seen to ooze secretion, and elephants have been observed rubbing their cheeks against trees, so temporin may have broader communication functions. Recent research has indicated that subordinate bulls produce a different chemical signal, with a sweet aroma, which may be used to signal submissiveness to the dominant bulls and so avoid attack.

Communication
Elephants have relatively poor vision, but highly developed senses of taste and smell. They obtain chemical cues by using their trunks to touch each other’s genitals, mouths, temporal glands, and urine. They also often lift their trunks and rotate the open tips, testing the air for the scent of other animals in the vicinity. It is very likely that they can identify different individual elephants from these cues.Elephants also have acute hearing and communicate through a wide variety of vocalisations. At least 25 different calls, audible to the human ear, have been identified in African elephants, 15 of them in a low-frequency group termed rumbles. Some of them are known to be associated with different events such as musth in a bull and oestrus or copulation in a female. In addition, a range of infrasound vocalisations extends down to 5 Hz, well below the frequency of human hearing. Low-frequency sound is less subject to environmental attenuation, and elephant rumbles and infrasound are audible to other elephants over a range of up to 5 km. It has also been suggested that elephants may communicate over even longer distances as they stamp their feet on the ground, but this theory remains to be tested.

Longevity
An elephant can live to around 60 years; many die before this age, from disease, injury, starvation, drought, or predation (though the latter is rare for healthy adult animals). A remarkable aspect of elephant behaviour is their response to injured, sick and dead members of their species. Many accounts have been recorded: adult females circling around a wounded animal to prevent further attack; lifting a wounded animal to its feet and shouldering it to safety; jumping into water where a wounded animal has fallen, and heaving it out again; pulling and pushing a calf out of mud where it had become stuck; standing guard over a stricken but living animal lying on the ground; covering the body of a relative with grass and leaves as soon as it had died; returning to the carcass or even skeleton of a dead relative; and tasting, picking up, and moving the remains with their trunks.

Movement
The idea of an elephant graveyard, a place where elephants go to die, is a myth. Sick and dying elephants often go to a lakeside or river, where there is a ready supply of food and water within easy reach, and several might die in one area for that reason. In times of drought, animals congregate around water holes and many may die there.Elephants are not territorial. Although individuals or family units have home ranges, those of different animals overlap and are not defended as such. There are daily and seasonal activity patterns within the home range. They sleep lying down, usually for two to four hours in the early morning. They may also, in the hottest part of the day, stand motionless in the shade, but even when the eyes are closed, they are most likely dozing rather than sleeping.Seasonal movements, particularly in open country, may see large aggregations of hundreds of animals. In other situations, particularly in forest environments, matriarchs lead their families along the same paths that have been used for generations; these elephant trails, trampled, barren ground 1-2 m wide, can extend for tens of kilometers.Elephants walk or amble, but cannot canter or gallop. A charging animal can attain 5m per second (20 kph), while walking speed ranges from 0.5 – 2.5 m per second (2 – 10 kph). Elephants walk cautiously, appearing to place each foot with care to avoid ground that is too soft or cobbled, for example. Even so, they can manoeuvre very dense terrain and can climb up and down remarkably steep, slippery slopes. They are also adept swimmers, paddling with all four feet and using the trunk as a snorkel.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Elephants eat vegetation like leaves, roots, bark, grasses and fruit. Each day they can consume anywherefrom 100 to 300 kilograms (220 to 660 lbs) of food, and up to 190 liters (50 gallons) of water.

African Elephants live in herds of up to 200 adult females and their young. Herds are generally led by the oldest female or matriarch. She determines when the group will eat, rest, bathe or drink. Once they reach sexual maturity, males leave their group to live on their own or in smaller bachelor herds.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Elephants have one of the longest lifespans of all mammals- about seventy years. Their age can be determined by height comparison to the matriarch, tusk length, or more complicated methods like measuring the weight of an eye lens from an elephant that recently died. Aging elephants faces appear sunken and their ears fold toward their body as they get older. They may also suffer from arthritis, tuberculosis or blood diseases like septicemea. Accidental death can occur if an elephant falls down a hill, or if it loses a fight with another elephant. Deaths from poaching still outnumber any natural or accidental occurrences of death in elephants.

(Estes, 1999; Payne, Langbauer, Jr., 1992; Moss, 1992)

Average lifespan

Status: wild:
70 years.

Average lifespan

Status: wild:
60.0 years.

Average lifespan

Status: captivity:
80.0 years.

Average lifespan

Status: wild:
70.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 65 years (captivity) Observations: Under optimal conditions, males attain sexually maturity at about 10 years of age and females at 11 years of age. Some animals, however, may not reach sexual maturity until they are 20 years old, and males generally do not reproduce until they are over 20 years of age. Elephants are long-lived mammals, but probably not as long-lived as often cited. Females remain fertile for about 55-60 years and elephants have been estimated to live up to 70 years in the wild (Ronald Nowak 1999). More conservative estimates suggest elephants live up to 65 years in the wild (Wiese and Willis 2004). In captivity, there are anecdotal reports of animals living over 80 years. Record longevity, however, belongs to one wild born female that was still living at 53-54 years of age (Richard Weigl 2005). Despite having as much as six sets of molars in a lifetime, elephants suffer from teeth erosion as a type of mechanical senescence.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

A females' estrus period lasts for about forty-eight hours. A bull in musth, a heightened state of sexual aggression and activity, must determine if the cow is in estrus by smelling her genitals. He inhales with the end of his trunk rubbing her genitals, then exhales with the end of the trunk in his mouth. This sends chemicals to his Jacobson’s organ, located in the palate, to test her condition for mating.  Larger males with the largest tusks are usually around fifty years old and do most of the breeding; leaving the younger bulls to roam until a mate is found. Males constantly search for mates and rarely stay for more than a few weeks with a female and her herd.

Mating System: polygynous

Elephants do not have any specific mating season. During the rainy seasons the reproductive rate is higher while times of drought or crowded conditions result in a lower reproductive rate. After a 22-month gestation period, single elephant calves are born weighing about 265 pounds (120-130 kg), twins are rare. A short time after birth, they instinctively are able to follow their mothers. Females give birth every four to nine years. Older calves are weaned a few months before the next is born.

Sexual maturity is reached between 10 and 12 years of age. African elephant live about 70 years, they continue to grow in height during their lives, reaching a maximum of 13 ft (4-4.5 m) for males, and 9 ft (approx. 2.5-3 m) for females.  (Estes, 1999; Eltringam, 1992)

Breeding interval: Females give birth every four to nine years.

Breeding season: Births occur more frequently during rainy seasons, but may occur throughout the year.

Range number of offspring: 2 (high) .

Average number of offspring: 1.

Average gestation period: 22 months.

Average weaning age: 48-108 months.

Average time to independence: 48-108 minutes.

Average age at sexual or reproductive maturity (female): 10-12 years.

Average age at sexual or reproductive maturity (male): 10-12 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 105000 g.

Average gestation period: 670 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
3650 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
4018 days.

The calf is born into a nurturing herd of related females and young males. After a gestation period of 20-22 months, they are precocial as they can see, smell, and walk a short time after birth. These well-developed calves are guarded and taken care of by their allomothers; young females who assist the calf’s mother. Elephant cows of the herd, which are typically related, frequently suckle each others' calves. Daughters remain in their natal herd for life, sons leave their natal herd once they reach sexual maturity.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

  • Eltringam, S., K. Payne, W. Langbauer, Jr., C. Moss, J. Shoshani. August, 1992. Elephants, Majestic creat. Pennsylvania: Rodale Press.
  • Moss, C. 1988. Elephant Memories. New York: William and Morrow Co.
  • Estes, R. 1999. "Elephants, reprinted from "The Safari Companion"" (On-line). Accessed October 5, 2001 at http://nature-wildlife.com/eletxt.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Skin fine-tunes internal temperature: African elephant
 

The skin of elephants allows them to fine-tune thermal regulation via 'hot spots', patches of skin that are highly vascularized.

     
  "In this study, we examined infrared thermograms in the course of time of  six African zoo elephants and observed two phenomena. First, we noticed  independent thermal windows, highly vascularised skin areas, on the whole elephants' body  and second we observed distinct and sharply delimited hot sections on  the elephants' pinnae. The frequency of thermal windows increased with  increasing ambient temperature and body weight. We assume that the  restriction of an enhanced cutaneous blood  flow to thermal windows might enable the animal to react more flexibly  to its needs with regard to heat loss. With this understanding, the use  of thermal windows in heat loss might be seen as a fine-tuning mechanism  under thermoneutral conditions." (Weissenböck et al. 2010:182)

  Learn more about this functional adaptation.
  • Weissenböck NM; Weiss CM; Schwammer HM; Kratochvil H. 2010. Thermal windows on the body surface of African elephants (Loxodonta africana) studied by infrared thermography. Journal of Thermal Biology. 35(4): 182-188.
  • Gray R. 2010. Elephants use 'hot spots' to stay cool. Telegraph.co.uk [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physical characteristics

Size
African elephants weigh 200–265 lb (90–120 kg) at birth. Unlike other mammals, they continue to grow well into adult life. Females cease growth at 25–30 years, males at 35–45. Fully-grown savannah elephants, L. a. africana, weigh 4–7 tonnes and measure 2.5–4m high at the shoulder. The have a concave, ‘saddle-shaped’ back. Forest elephants, L. a. cyclotis, weigh 2–4 tonnes, for a shoulder height of 1.8–3 m, and have a straighter back. In comparison with the Asian species (Elephas maximus) the head is less high and is single-domed; the ears are larger, and fold back at the top; and there are two ‘fingers’ at the end of the trunk. Both sexes possess tusks, those of the female being relatively smaller, whereas in the Asian species the females generally lack tusks.

Head
The elephant’s head is proportionately very large, weighing up to half a tonne; the neck is short. The body is supported on four extremely strong pillar-like legs. The elephant has five splayed toes buried within its foot, and stands on tip-toe; the first visible joint, some distance above the ground, is not the elbow or the knee, but the wrist or ankle. The foot contains a pad of springy tissue that causes the elephant’s foot to swell sideways when it bears the animal’s weight. The tail is long, extending to below the knee, and ends in a tuft of very coarse hairs. Otherwise, the body is sparsely covered by short hair, more pronounced in very young animals. As far as is known, there are no sweat glands. The ears are very large and thin, except for a thicker supporting ridge along the top. They are richly supplied with blood vessels for heat loss, and are flapped mainly for this purpose. The skin is a uniform gray. Elephants may take on brown or other hues after wallowing in mud.

Trunk
The elephant’s trunk is, anatomically, a fusion between its nose and upper lip. The trunk is remarkably sensitive, flexible, and manoeuvrable, as well as being immensely strong. It contains no bone or cartilage, but is principally composed of muscle, in eight main sets (four on each side) comprising a total of about 150,000 separately moveable muscle units. Two nostrils run the entire length of the trunk for breathing.

Tusks
The tusks are, anatomically, greatly expanded lateral incisor teeth. They are comprised almost entirely of dentine. About a third of their length is buried within a socket in the animal’s skull. The tusks are solid, except the upper part within the socket, where there is a pulp cavity. The tusks grow by addition of dentine there, pushing them out by up to 6in (15cm) a year. The tusks of a large bull can extend 79 in (200cm) in total length and weigh 110lb (50kg) each, although such figures are rare nowadays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loxodonta africana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTTGCTAACCGCTGACTATATTCAACGAACCACAAAGATATCGGAACACTGTATCTATTATTTGGTGCTTGAGCTGGTATAGTAGGGACTGCTTTTAGTATCCTAATTCGGGCAGAACTAGGCCAACCAGGCTCTCTTCTTGGAGATGATCAAATCTACAATGTTATTGTCACAGCACACGCCTTCGTAATAATCTTCTTTATAGTCATGCCAATTATAATTGGAGGCTTTGGAAACTGGTTAATTCCACTTATAATTGGAGCACCTGATATAGCTTTTCCTCGAATAAACAATATGAGTTTTTGACTACTGCCTCCATCTTTCCTACTACTTTTAGCATCCTCTATAGTAGAAGCTGGGGCAGGCACTGGTTGGACCGTATACCCTCCCCTGGCAGGAAACCTGGCCCATGCAGGAGCTTCTGTGGATTTAACTATTTTTTCACTTCACCTTGCAGGAGTATCCTCTATTCTAAGTGCAATTAATTTTATCACTACCATCATCAACATAAAACCTCCAGCTATATCTCAATACCATATACCCTTATTTGTATGGTCCATTTTAATTACAGCCGTCCTTCTTCTTCTATCCCTCCCAGTTCTAGCAGCAGGTATTACAATATTACTAACGGATCGCAATCTCAATACTACTTTTTTTGATCCTGCAGGAGGAGGAGACCCAATTCTATATCAACACCTATTCTGGTTTTTTGGACACCCTGAAGTCTATATTCTAATTCTCCCAGGATTTGGAATAGTTTCTCATATCGTTACATACTACTCAGGAAAAAAAGAACCCTTCGGTTATATAGGGATAGTATGGGCTATAATATCAATTGGCTTCCTAGGATTTATTGTATGAGCCCACCATATATTCACCGTAGGCATAGACGTTGACACTCGAGCTTACTTTACATCAGCTACTATAATTATTGCTATTCCAACTGGCGTAAAAGTCTTTAGTTGACTAGCTACCCTTCATGGCGGTAATATTAAATGATCCCCCGCTATAATATGAGCTCTAGGATTTATCTTCTTGTTTACAATTGGAGGATTAACTGGCATTGTTCTTGCTAATTCTTCACTAGACATTGTCCTACATGACACCTACTACGTTGTAGCTCACTTTCACTACGTCTTGTCTATAGGTGCAGTTTTCGCCATTATGGGTGGATTTATCCACTGATTTCCACTATTTTCAGGATACACATTAAATTATACATGAGCTAAAATTCAATTCCTAGTTATATTTATTGGTGTTAATTTGACATTTTTTCCCCAACACTTTCTTGGACTATCTGGTATGCCACGTCGATATTCTGACTATCCAGATGCCTATACTGCATGAAATACTGCCTCTTCTATAGGTTCATTTATCTCTTTAGTAGCCGTAATTCTAATAGTCTTTATAATTTGAGAGGCATTTGCTTCTAAGCGCGAAGTTTCTGTGATAGAACTCACAACAACAAACGTAGAATGACTCAACGGATGTCCACCTCCACATCATACATTCGAAGAACCAGCCTACGTAAAATCTAACTCGAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loxodonta africana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2a

Version
3.1

Year Assessed
2008

Assessor/s
Blanc, J.

Reviewer/s
Balfour, D., Craig, C., Dublin, H.T. & Thouless, C. (African Elephant Red List Authority)

Contributor/s

Justification
Background Considerations and Choice of Criteria
The species is the largest terrestrial animal and has been the subject of considerable research, but continent-wide distribution and density estimates are difficult to obtain for any one time period. To a large extent this is due to the enormous range covered by the species (and thus the cost of estimating its numbers) as well as to the wide variety of habitats it occupies (often woodland and forest where visibility is poor from the ground as well as from the air; see Habitats list). These difficulties, coupled with the differential influence that various historical factors have played in different parts of the continent, result in a continental picture of the status of the African Elephant that varies considerably – qualitatively and quantitatively – across its range.

Although our knowledge of the status of African Elephants across their range has been progressively improving since the mid-1990s, when considerable resources began to be channelled into compiling and producing regular updates of the continental status of elephants with a standardized measure of certainty (Said et al. 1995; Barnes et al. 1999; Blanc et al. 2003; Blanc et al. 2007), large gaps still remain.

In investigating the Red List Criteria (Version 3.1) against these realities, it became clear to the group of assessors involved in the 2004 assessment, that the variability in population trends and levels of uncertainty would preclude a full quantitative Red List assessment, such as would be conducted under criterion E. It was therefore agreed that a compromise approximation would have to be made, and that the African Elephant Specialist Group would be best placed to undertake this task. In order to facilitate the process, extensive use was made of the Guidelines for Application of IUCN Red List Criteria at Regional Levels (IUCN 2003).

The criterion used for the categorization was criterion A. Criteria B, C and D are not applicable as the species currently occupies more that 20,000 km² and there are more than 10,000 mature individuals. No quantitative analysis was conducted and therefore criterion E does not apply. Substantial resources would be required to undertake a consensus-driven modelling approach, which would inevitably be based on a great deal of uncertainty with regard to some of the key parameters, including estimates of both human and elephant population size, as well as the scale and extent of threats to the species and its habitats. While ivory export records and other indirect data could be used to derive these models, they would still encounter the many uncertainties inherent in the reconstruction of events covering the better part of a century.

Subcriterion A2a was used because some of the major causes for decline, such as habitat loss due to human population expansion, have not ceased and may not be reversible throughout the species' range. While the recent data used in the assessment are based on direct observation, the population size reduction over three generations is only inferred (see below).

Methodology
A generation time of 25 years, calculated as the average age of reproductive females, was established using data from many culling exercises in Kruger National Park, South Africa (I. Whyte pers. comm.).

There are no credible estimates for a continental population prior to the late 1970s. Thus for the continental (global) population, an extrapolation back to the beginning of three generations is plagued with high levels of uncertainty. Clearly, forward extrapolation to the mid-21st Century would also be troubled by uncertainty, not only for the reasons cited above, but also because of the variety of causes for decline and the nature of the current and likely future threats - mainly habitat loss and illegal hunting for both meat and ivory - which are in themselves variable in intensity across the continent.

One of the key components of the methodology adopted at the AfESG’s 2003 Etosha meeting was the assumption that continental elephant populations increased during the first half of the 20th century (as a result of the decline of the ivory trade from the outbreak of WWI, improved protection measures, and an increase in preferred secondary forest habitat in Central Africa), reaching a peak in the late 1960s and declining from then until the late 20th century.

In addition, African Elephant population trends in the course of the 20th century are believed to have differed considerably across the different African sub-regions (see Figure 1 in the attached PDF). In Eastern Africa, for instance, there is a general consensus that there was a peak (regional population maximum) around the late 1960s and early 1970s, followed by a decline in the 1980s and subsequent recovery in recent years (Blanc et al. 2005, 2007). In Southern Africa, which now harbours the largest known populations on the continent, elephant numbers are believed to have been at their lowest around the turn of the 20th century, and to have been increasing steadily ever since. The magnitude of the decline in Eastern Africa has in all likelihood been offset by the magnitude of the increase in Southern Africa. In West Africa, major declines probably occurred well before the turn of the 20th century and the population has remained at low levels ever since. There is insufficient information on sub-regional trends in Central Africa prior to 1977, but elephant populations are believed to have declined since that time. This is important as Central Africa accounts for a large proportion of the estimated continental range, but our knowledge of its current population size is the poorest.

Taking these problems into account, the consensus among contributors to the 2004 assessment was that it would be an appropriate and acceptable compromise, more likely to err on the conservative side relative to the final listing, to assume the continental population of three generations back (1927) to be equal to that of the first continental estimate in 1977. As the data used for the 2004 assessment were from 2002 (see section on 'Further Details on Data Used' in the attached PDF), it was thus assumed that the population in 1927 was approximately equal to the population estimate for 1977 derived by the contributors to the 2004 assessment.

For the present assessment, which uses 2006 data for the current generation, a comparison had to be made between 2006 and 1931. No consensus population estimate for 1931 is available for this assessment. Had the population remained constant or declined between 1927 and 1931, a comparison with the 2006 data used in this assessment would have resulted in a downlisting of the species to Near Threatened (NT). As mentioned above, however, according to the methodology and assumptions adopted at the 2003 AfESG meeting in Etosha, elephant populations were assumed to be increasing through the first part of the 20th Century. The extent to which the continental population would have increased is unknown. However, calculations reveal that, given the assumptions above, an annual rate of increase of greater than 1.53% would result in the species remaining in the Vulnerable category, and a rate of 1.53% or less would result in the species being re-categorized as Near Threatened. Under the conditions likely prevailing at the time the African Elephant Red List Authority believes that the likely annual rate of increase could easily have exceeded 1.53%. The conservative decision, again relative to the final global listing, is thus to accept a growth rate of greater than 1.53% per annum and to retain the African Elephant in the Vulnerable category in this assessment.

Changes to Status
The African Elephant was listed as Vulnerable (VU A2a) in the 2004 IUCN Red List, under the same IUCN Categories and Criteria used in this assessment (Version 3.1).

Prior to the 2004 assessment, the species was listed as Endangered (EN A1b) under the IUCN Categories and Criteria Version 2.3 (1994), in an assessment conducted in 1996 by the IUCN SSC African Elephant Specialist Group.

Regional Assessments
The status of African Elephants varies considerably across the species' range. These differences broadly follow regional boundaries, and are partly a result of the different historical trends. To better reflect this variation in status, it was decided to include in this assessment regional-level listings for the four African regions in which elephants occur (see Figure 2 in the attached PDF). The methodology and criteria used in these regional assessments is identical to that used for the global assessment, but employing only the relevant subsets of data. An exception to this rule is West Africa, where a more precautionary listing was obtained through the application of a different Red List Criterion. The results of the regional assessments are presented in Table 1 of the attached PDF.

History
  • 2004
    Vulnerable
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The African Elephant Conservation Act of 1988 is in full effect today, which bans any trade in ivory. The species’ status on the CITES appendix has moved to #1, from a monitored amount of trade to none. Though some conservation programs offer rewards, people have made movements to conserve and live with the elephants without being repaid. Conservation facilities exist in Africa, and societies to fuel them exist worldwide in Cameroon, England, Germany, Kenya, Netherlands, Sri Lanka, South Africa, Zimbabwe, Sweden, Tanzania, Thailand and the United States. In central eastern Africa, a number of wildlife conservancies hope to give endangered species a large protected area to live in and reproduce. They hope to see more action taken on predators and stop the illegal trade in ivory. Some parks and other areas that are being populated more and more with humans must control the number of elephants by controlled killing, or culling.

(CITES, 2001)

US Federal List: threatened

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 06/11/1978
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: T

For most current information and documents related to the conservation status and management of Loxodonta africana , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Status: VULNERABLE

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1), and listed on Appendix II on the Convention on Migratory Species (CMS or Bonn Convention) (3). Listed in CITES Appendix I in 1989, but the populations of the following Range States have since been transferred back to Appendix II: Botswana (1997), Namibia (1997), South Africa (2000) and Zimbabwe (1997) (4). Preliminary genetic evidence suggests that there may be at least two species of African elephants, namely the savanna elephant (Loxodonta africana) and the forest elephant (Loxodonta cyclotis). However, many conservationists believe there is as yet insufficient evidence to justify this distinction (5), and that premature allocation into more than one species may leave hybrids in an uncertain conservation status (1). For this reason, the IUCN Red List assessment is for the single species, encompassing both forest and savanna populations (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Although elephant populations may at present be declining in parts of their range, major populations in Eastern and Southern Africa, accounting for over two thirds of all known elephants on the continent, have been surveyed,and are currently increasing at an average annual rate of 4.0% per annum (Blanc et al. 2005, 2007). As a result, more than 15,000 elephants are estimated to have been recruited into the population in 2006 and, if current rates of increase continue, the number of elephants born in these populations between 2005 and 2010 will be larger than the currently estimated total number of elephants in Central and West Africa combined. In other words, the magnitude of ongoing increases in Southern and Eastern Africa are likely to outweigh the magnitude of any likely declines in the other two regions.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Poaching for ivory and meat has traditionally been the major cause of the species' decline. Although illegal hunting remains a significant factor in some areas, particularly in Central Africa, currently the most important perceived threat is the loss and fragmentation of habitat caused by ongoing human population expansion and rapid land conversion. A specific manifestation of this trend is the reported increase in human-elephant conflict, which further aggravates the threat to elephant populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats conservation

Elephants are faced with a dual threat to their survival
  • The destruction of their habitat
  • Hunting
The former is common to many other species, the latter is due to the elephant’s possession of a precious commodity - ivory.

Habitat destruction
Habitat destruction has both reduced the total range of elephants, and has greatly fragmented it. The principal cause is human settlement and agriculture due to population growth, but activities such as logging for financial gain also contribute.Over much of the range, the remaining areas of habitat correspond to national parks, nature reserves and the like. Many of these fragments retain less than 100 individuals, and prospects for their long-term survival are not good. If there is no exchange of individuals with other populations, inbreeding reduces the genetic health of the population. If climatic fluctuations produce a series of stressful years, the population will suffer increased mortality and reduced birth rate, and may not recover.In West Africa through the 1980s, elephant populations in habitat fragments of less than 250 km2 had only a 20% chance of surviving the decade, while those in areas of more than 750 km2 had almost a 100% chance of survival.

Hunting
The hunting of elephants for meat has been practised since prehistoric times, but only with the use of firearms has the thirst for ivory posed a threat to the very survival of the species. By 1800, the elephant populations of southern and West Africa had already been seriously depleted. A century later, the trade from Africa had increased to 1000 tonnes per year. The 1970s and 1980s proved critical: the total African population fell from an estimated 1.3 million animals in 1979, to just over 400,000 in 1987.Combating the ivory trade is a complex issue that requires the enforcement not only of bans against hunting, but international action to trace the organizers of poaching, the middle men, and the ultimate consumers.

Conservation
From its foundation in the 1970s, CITES (The Convention on International Trade in Endangered Species) placed African elephants on its Appendix II (allowing limited trading). In 1989, however, they were raised to Appendix I, effectively banning all trade in elephant ivory. The policy worked: ivory prices fell, and many countries reported a drastic reduction in poaching. However, in 1997, some southern African countries with healthy elephant populations won from CITES permission to sell their ivory stocks. The market was stimulated, and in subsequent years, increased poaching has been reported by a number of African countries. Nevertheless, in 2002, and again in 2007, CITES allowed further sales of stockpiled ivory by these countries, despite almost universal opposition from conservation organisations, who argue that such sales only serve to stimulate the ivory trade and illegal killing of elephants.A recent report (http://www.guardian.co.uk/environment/2010/jan/17/illegal-ivory-trade-poachers-africa) indicates that there is a massive current surge in ivory trading: more than 14,000 products made from the tusks and other body parts of elephants were seized in 2009. It is estimated that between 8% and 10% of Africa’s elephants are now being killed each year to meet the demand, mostly from the Far East. With the current world population of African elephant at around 300,000-400,000, this represents an annual take of up to 40,000 animals and is clearly not sustainable.The management and protection of elephant habitats is also a major goal. International support enabling poor countries to maintain existing wildlife reserves, or to create new ones, is crucial. Properly managed eco-tourism can be beneficial, as it provides an income underscoring the value of the reserve. Yet small reserves, even when protected, may not support enough animals to give a viable population. Raman Sukumar has suggested that 50 breeding individuals, translating into 125-150 animals, is a minimum goal, with 10 times that number an ideal. One solution to this problem is to create corridors of habitat, allowing animals to migrate between parks, so that populations are effectively merged into one, viable unit.

Elephant-human conflict
Elephant-human conflict is a serious issue in some areas. Elephants enter agricultural areas and can destroy the entire crop of a smallholding in a single night. Traditional countermeasures include lighting flares, throwing rocks, employing domestic elephants to chase away the marauders, or digging trenches around fields. The latter are of some use but elephants learn how to fill them with earth or logs. Electric fences are employed by rich landowners, but are too expensive to bound large national parks or small private holdings. Other measures include not planting crops favoured by elephants in the area around their habitat, and relocating farms and villages (with compensation paid to the farmers). The latter may also be necessary when extending reserves or creating habitat corridors.In some African countries, elephant populations in wildlife parks have been held in check by government-approved culling. The stated rationale is to prevent the populations increasing to the point where they turn woodland into grassland, reducing biodiversity, and leading to elephant mortality when drought hits, as happened in Tsavo National park, Kenya, in the 1960s and 1970s. Opponents counter that culling (sometimes of entire family groups) is inhumane and causes stress to surviving animals; is a temptation for illicit ivory dealing; interferes with natural cycles; and depresses tourism. Possible alternatives include relocating animals to areas of low density and subcutaneous implants of birth-control hormones.While elephants in Asia (Elephas maximus) have been domesticated for thousands of years, the African elephant has been domesticated only rarely. This difference appears to be for human cultural reasons rather than any innate inability of the species to be domesticated. The Carthaginians fought the Romans with them, and Hannibal’s famous crossing of the Alps was probably with the help of the African species. In modern times, Belgian colonisers domesticated elephants for traction and other uses in Central Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Elephants have been hunted over the centuries for their tusks, which are traded as ivory (2). In the 1970s to 80s, an increased demand in ivory had a negative impact on elephant numbers across much of the species' range (12). Kenya was one of the worst affected countries (8), where the population plummeted by perhaps as much as 85 percent between 1973 and 1989 (12). Today, one of the major issues in elephant conservation is the conflict between elephants and a growing human population (2). Up to 80 percent of the elephant's range occurs outside of protected areas, where they frequently cause widespread damage to agriculture and water supplies (13). This conflict often results in injury or death for both people and elephants (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The African Elephant has been listed in CITES Appendix I since 1989, but the populations of the following Range States have since been transferred back to Appendix II with specific annotations: Botswana (1997), Namibia (1997), South Africa (2000) and Zimbabwe (1997). These annotations have been recently replaced by a single annotation for all four countries, with certain specific sub-annotations for the populations of Namibia and Zimbabwe.

The African Elephant is subject to various degrees of legal protection in all Range States. Although up to 70% of the species range is believed to lie in unprotected land, most large populations occur within protected areas.

Conservation measures usually include habitat management and protection through law enforcement. Successful management at the site level can result in the build-up of high elephant densities. This is often perceived as a threat to their local habitats, as well as to other species and to elephant populations themselves. Management interventions to reduce elephant numbers and local densities have been limited and most recently been undertaken through contraception or translocation. Large-scale culling has not been performed as a population management option since Zimbabwe discontinued the practice in 1988 and South Africa did likewise in 1994.

The sport hunting of elephants is permitted under the legislation of a number of Range States, and the following countries currently (2007) have CITES export quotas for elephant trophies: Botswana, Cameroon, Gabon, Mozambique, Namibia, South Africa, Tanzania, Zambia and Zimbabwe.

Some community-based conservation programmes in which revenue from the sport hunting of elephants reverts directly to local communities have proved effective in increasing tolerance to elephants, and thus indirectly in reducing levels of human-elephant conflict.

An increasing number of transboundary elephant populations are co-managed through the collaboration of relevant neighbouring Range States. Large-scale conservation interventions are also planned through the development of conservation and management strategies at the national and regional level.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A ban on the international trade in elephant products including ivory was implemented in 1990, when the African elephant was added to Appendix I of the Convention on International Trade in Endangered Species (CITES), although the populations of Botswana, Namibia, South Africa and Zimbabwe have since been transferred to Appendix II (4). Indeed, sport hunting of elephants remains permitted under the legislation of a number of range states, and several countries currently have CITES export quotas for elephant trophies (1). Nevertheless, protection of the species has been high-profile in many countries, often involving armed guards, and the Kenyan Wildlife Service famously burnt a stockpile of tusks in protest against the ivory trade (7). The African Elephant Specialist Group (AfESG) of the IUCN/SSC (Species Survival Commission) has also set up a Human Elephant Conflict Working Group (HECWG) to address the issues of conserving a species that has the ability to be detrimental to a human population (14). Beyond the controversy surrounding the taxonomic status of African elephants, the IUCN African Elephant Specialist Group (AfESG) believes that different approaches are needed for the different problems facing the elephant in each country and region, and conservation strategies are therefore developed at the national or regional scales (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pleistocene Re-wilding

 

This species is one of a number which have been included in various “Pleistocene rewilding” plans. Pleistocene rewilding is the proposed practice of restoring ecosystems to their state in the Pleistocene, roughly 10,000 years ago. This contrasts the standard conservation benchmark, particularly in North America, of restoring ecosystems to their pre-Columbian or pre-industrial state. In both Eurasia and North America, the Pleistocene was characterized by much greater diversity and numbers of large herbivores and predators, including proboscidians, equids, camelids, and felidae (Donlan et al 2006; Zimov 2005). The process of restoration would involve the reintroduction of extant species in their historic range, as well as the introduction of ‘proxy organisms’ to replace the ecological functionality of extinct organisms (Donlan et al 2006). 

There are three central theoretical goals to Pleistocene rewilding. In Siberia, a team led by Sergey Zimov is investigating the role of large herbivores as ecosystem engineers. It is thought that herbivory pressure could play a central role in maintaining a grass-dominated plant community, as opposed to either tree- or moss-dominated. Grasslands are known to be more stable carbon sinks than either mossy or forested tundra, due to the rapidity of their biogeochemical cycling (Zimov 2005). In principle, then, reintroducing Pleistocene fauna could have positive climate change mitigation effects. Proposals in North America have focused instead on the preservation of ecological dynamics. Proponents of Pleistocene rewilding argue that due to the strong ecological interactions of megafauna, it is likely that their extinction at the end of the Pleistocene would have caused cascading ecological disruptions lasting until the present time (Donlan et al 2006). Additionally, introduction programs could provide a new lease on life for extant, endangered megafauna species, such as cheetahs and Asian elephants (Rubenstein 2006). 

Pleistocene rewilding, while headline-grabbing, is by no means the standard of modern conservation biology. There are a number of objections to the proposals of Pleistocene rewilders, summarized by Rubenstein et al (2006). The introduction of species which have been locally extinct for thousands of years, and more particularly the introduction of modern relatives of extinct species, carries many risks: the potential for invasive species, catastrophic disruption of existing ecosystems, inadvertent introduction of disease organisms, and unpredictable behavior of introduced species. Additionally, while paleoecology is a growing field, there is still a fair amount of uncertainty about the actual ecosystem functions of the Pleistocene.

Species which Zimov and his colleagues in Siberia are experimenting with bison, musk oxen, Przewalski’s horse, and Siberian tigers (Zimov 2005). Small-scale introductions have already begun in Yakutia. Donlan et al propose introducing Przewalski’s horse, Bolson tortoises, Bactrian camels, cheetahs, lions, and elephants into the Western United States (Donlan et al 2005). While some individuals of these species are present on privately owned land, there are no free-living populations in North America at this time. 

  • Donlan, CJ. 2005. Re-Wilding North America. Nature 436:913-914.
  • Donlan CJ, Berger J, Bock CE, Bock JH, Burney DA, Estes JA, Foreman D, Martin PS, Roemer GW, Smith FA, Soule ME, Greene HW. 2005. Pleistocene Rewilding: An Optimistic Agenda for Twenty-First Century Conservation. The American Naturalist 168:660-681.
  • Rubenstein DR, Rubenstein DI, Sherman PW, Gavin TA. 2006. Pleistocene Park: Does Rewilding North America Represent Sound Conservation for the 21st Century? Biological Conservation 132:232-238.
  • Zimov, SA. 2005. Pleistocene Park: Return of the Mammoth’s Ecosystem. Science 308:796-798.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 1 person

Average rating: 5.0 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Elephant foraging and wandering sometimes result in crop damage and damage to villages.

Negative Impacts: crop pest

  • Jackson, P. 1990. Endangered Species, Elephants. Secaucus, New Jersey: Chartwell Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans have previously profited from ivory as it was used for jewelry, sculptures, pianos, and tools. Their hides were sometimes used for clothes and blankets and the local people ate their meat.  Ecotourism activities revolving around seeing African elephants in the wild now provide significant sources of revenue for some regional economies in Africa.

Positive Impacts: body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

African Bush Elephant

See also: African Savanna Elephant
African Bush Elephant!<-- This template has to be "warmed up" before it can be used, for some reason -->

Bilateria

The African Bush Elephant (Loxodonta africana) is the larger of the two species of African elephant. Both it and the African Forest Elephant have usually been classified as a single species, known simply as the African Elephant. Some authorities still consider the currently available evidence insufficient for splitting the African Elephant into two species.[3] It is also known as the Bush Elephant.

Contents

Description

The African Elephant is the largest living terrestrial animal, normally reaching 6 to 7.3 metres (19.7 to 24.0 ft) in length and 3.5 to 4 metres (11.5 to 13.1 ft) in height at the head, and weighing between 6,000 to 9,000 kg (13,000 to 20,000 lb).

The largest on record, shot in Angola in 1965, was a bull weighing 12,274 kg (27,060 lb) and standing 4.2 metres (13.8 ft) high, the body of which is now mounted in the rotunda of the National Museum of Natural History in Washington, D.C.. (The museum's website states that the specimen weighs only 8 tons.[4]) The Bush Elephant normally moves at a rate of 6 km/h (4 mph), but it can reach a top speed of 40 km/h (25 mph) when scared or upset.

African Bush Elephant and her young

The animal is characterized by its large head; two large ears that cover its shoulders and radiate excess heat; a large and muscular trunk; two prominent tusks, which are well-developed in both sexes, although more commonly in males; a short neck; a large, barrel-like body; four long and heavy legs; and a relatively short tail.

The animal is protected by a heavy but flexible layer of gray-brown skin, dotted with mostly undeveloped patches of hair and long, black hair at the tip of its tail. Its back feet have three toes that form a hoof, while the number of toes on the front feet have varied between four and five. The forehead is smoother and less convex than that of the Asian Elephant.

The trunk is the most characteristic feature of the African Bush Elephant. It is formed by the fusion and elongation of the nose and upper lip, forming a flexible and strong organ made purely of muscle.

Little scientific research has been carried out into elephants' cognitive or perceptual abilities. An exception is a recent report that African Bush Elephants are able to use seismic vibrations at infrasound frequencies for communication.[5]

Diet

Elephant grasping a thorn tree

African Bush Elephants are herbivorous. Their diet varies according to their habitat; elephants living in forests, partial deserts, and grasslands all eat different proportions of herbs and tree or shrubbery leaves. Elephants inhabiting the shores of Lake Kariba have been recorded eating underwater plant life.[6] In order to break down the plants they consume, the African Bush Elephant has four large molars, two in each mandible of the jaw. Each of these molars is 10 cm wide and 30 cm long. Over time, these molars are worn away and new ones are grown to replace them as the elephant ages. Around the age of 15 their milk teeth are replaced by new ones that last until the age of 30, and then by another set which wear off past the age of 40, being replaced by the last set of teeth that last approximately until the age of 65–70. Not much later, the animal dies of starvation from not being able to feed correctly. There are known cases of over 80 year old specimens in captivity.

These animals typically ingest an average of 225 kg of vegetable matter daily, which is defecated without being fully digested. That, combined with the long distances that they can cover daily in search of more food, contributes notably to the dispersion of many plant seeds that germinate in the middle of a nutrient-filled feces mound. Elephants rip apart all kind of plants, and knock down trees with the tusks if they are not able to reach the tree leaves. In some national parks there is overpopulation, so that managers of overpopulated parks often contact other parks with fewer specimens to transfer excess individuals.

Elephants also drink great quantities of water, over 190 liters per day.

Social behavior

Male African Bush Elephant in Serengeti during the mating season

The African Bush Elephant is an intelligent animal. Experiments with reasoning and learning show that they are the smartest ungulates together with their Asian cousins. This is mostly due to their large brain.

A solitary old male elephant in Namibia

Herds are made up of related females and their young, directed by the eldest female, called the matriarch. Infrequently, an adult male goes with them, but those usually leave the pack when reaching adolescence to form bachelor herds with other elephants of the same age. Later they lead a solitary life, approaching the female herds only during the mating season. Nevertheless, elephants do not get too far from their families and recognize them when re-encountered. Sometimes, several female herds can blend for a period of time, reaching even hundreds of individuals.

The matriarch is the one who decides the route and shows to each other member of the herd all the water sources she knows, which the rest will memorize in the future. The relations among the members of the herd is very tight; when a female gives birth to a baby the rest go to acknowledge it touching her with the trunk; and when an old elephant dies the rest of the herd will stay by the corpse for a while. The famous elephant graveyards are a myth, but it is true that these animals can recognize a carcass of its species when they find one during their trips, and even if it is a stranger, they form around it and sometimes they even touch its forehead with their trunk.

Mating happens when the female becomes receptive, an event that can occur anytime during the year. When she is ready, she starts emitting infrasounds that attract the males, sometimes from kilometers away. The adult males start arriving at the herd during the following days and begin fighting, causing some injuries and even broken tusks. The female shows her acceptance of the victor by rubbing her body against his. They mate, and then both go their own way. After 22 months of gestation (the longest among mammals), the female gives birth to a single 90 cm high calf which weighs more than 100 kg. The baby feeds on the mothers milk until the age of 5, but also eats solid food from as early as 6 months old. Just a few days after birth, the calf can follow the herd by foot.

Some African Bush Elephants will attack and kill rhinoceroses. This behavior, when it occurs, is mostly observed with younger adult male elephants who have come into musth prematurely.

Predators

Men with ivory tusks, Dar es Salaam, c. 1900

The adult African Bush Elephant generally has no natural predators due to its great size,[7] but the calves (especially the newborn) are vulnerable to lion and crocodile attacks, and (rarely) to leopard and hyena attacks. Predation, as well as drought, contribute significantly to infant mortality.

Humans are the elephant's major predator. Elephants have been hunted for meat, skin, bones, and tusks. Elephant trophy hunting increased in the 19th and 20th centuries, when tourism and plantations increasingly attracted sport hunters. In 1989, hunting of the African Bush Elephant for ivory trading was forbidden, after the elephant population fell from several million at the beginning of the 20th century to fewer than 700,000. Trophy hunting continues today. The population of African Bush Elephants was halved during the 1980s. Scientists then estimated that, if no protective measures were taken, the wild elephant would be extinct by 1995. The protection that the elephant now receives has been partially successful, but despite increasingly severe penalties imposed by governments against illegal hunting, poaching is still common. CITES still considers this species as threatened with extinction.

Species differences

Female African Bush Elephant Loxodonta africana in an English zoo. The reddish color of its skin comes from the red earth found in the area.

A 2010 genetic study confirmed that the African Bush Elephant and the African Forest Elephant are distinct species.[8] By sequencing DNA of 375 nuclear genes, scientists determined that the two species diverged around the same time as the Asian elephant and the woolly mammoth and are as distinct from one another as those two species.[9] As of December 2010, conservation organizations such as the United Nations Environment Programme's World Conservation Monitoring Centre and the International Union for Conservation of Nature (IUCN) had not distinguished between the two species of African elephants for purposes of assessing their conservation status. As of March 2010, the IUCN Red List classified African elephants as a whole as vulnerable species and the Central African elephant population (forest elephants) as Endangered.[2]

Another possible species or subspecies formerly existed, but although formally described [10][11] it has not been widely recognized by the scientific community. The North African Elephant (Loxodonta africana pharaohensis), also known as the Carthaginian Elephant or Atlas Elephant, was the animal famously used as a war elephant by Carthage in its long struggle against Rome.[citation needed]

Conservation

Female African Bush Elephant in the Roger Williams Zoo, Providence, RI

While the species is designated as vulnerable,[2] conditions vary somewhat by region within Eastern and Southern Africa.

In 2006, an elephant slaughter was documented in southeastern Chad by aerial surveys. A series of poaching incidents, resulting in the killing of over 100 elephants, was carried out during the late spring and summer of 2006 in the vicinity of Zakouma National Park.[12] This region has a decades-old history of poaching of elephants, which has caused the elephant population of the region, which exceeded 300,000 in 1970, to drop to approximately 10,000 today. The African Bush Elephant officially is protected by Chadian government, but the resources and manpower provided by the government (with some European Union assistance) have proven insufficient to stop the poaching.[13]

Human encroachment into or adjacent to natural areas where Bush Elephants occur has led to recent research into methods of safely driving groups of elephants away from humans, including the discovery that playback of the recorded sounds of angry honey bees are remarkably effective at prompting elephants to flee an area.[14]

References

  1. ^ Shoshani, Jeheskel (16 November 2005). "Order Proboscidea (pp. 90-91)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 91. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=11500009. 
  2. ^ a b c Blanc, J. (2008). Loxodonta africana. In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.1. Downloaded on 04 April 2010.
  3. ^ IUCN African Elephant Specialist Group (AfESG): Statement on the Taxonomy of extant Loxodonta (February, 2006)
  4. ^ National Museum of Natural History: Exhibits
  5. ^ Günther, R. H., O'Connell-Rodwell, C. E., & Klemperer, S. L. (2004). "Seismic waves from elephant vocalizations: A possible communication mode?". Geophysical Research Letters 31: L11602. doi:10.1029/2004GL019671. 
  6. ^ [1]
  7. ^ ADW: Loxodonta africana: Information
  8. ^ Rohland, Nadin; Reich, David; Mallick, Swapan; Meyer, Matthias; Green, Richard E.; Georgiadis, Nicholas J.; Roca, Alfred L.; Hofreiter, Michael (December 2010), "Genomic DNA Sequences from Mastodon and Woolly Mammoth Reveal Deep Speciation of Forest and Savanna Elephants", PLoS Biology 8 (12): e1000564, doi:10.1371/journal.pbio.1000564, http://www.plosbiology.org/article/info:doi/10.1371/journal.pbio.1000564 
  9. ^ Steenhuysen, Julie (December 22, 2010), "Africa has two species of elephants, not one", Reuters, http://www.reuters.com/article/idUSTRE6BK6I920101222 
  10. ^ Nowak, Ronald M. (1999), Walker's Mammals of the World, 6th edition, Baltimore and London: The Johns Hopkins University Press, pp 1002.
  11. ^ Yalden, D.W., M.J. Largen and D. Kock (1986), Catalogue of the Mammals of Ethiopia.6. Perissodactyla, Proboscidea, Hyracoidea, Lagomorpha, Tubulidentata, Sirenia, and Cetacea, Italian J. Zool., Suppl., n.s., 21:31-103.
  12. ^ Handwerk, Brian (2006-08-30). "African Elephants Slaughtered in Herds Near Chad Wildlife Park". NationalGeographic.com. http://news.nationalgeographic.com/news/2006/08/060830-elephants-chad.html. Retrieved 2006-09-01. 
  13. ^ Goudarzi, Sara (2006-08-30). "100 Slaughtered Elephants Found in Africa". LiveScience.com. http://www.livescience.com/animalworld/060830_chad_elephants.html. Retrieved 2006-08-31. 
  14. ^ Lucy E. King, Iain Douglas-Hamilton, Fritz Vollrath (2007) African elephants run from the sound of disturbed bees. Current Biology 17: R832-R833
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!