Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Distribution

Range Description

The range of this species extends from southern Mexico (Oaxaca and Tabasco), through Central America to Colombia, northwestern Venezuela, Guyana, French Guiana, Suriname, the mouth of the Amazon river in Brazil, Ecuador, Peru, Paraguay, southern Brazil, and northeastern Argentina (Misiones) (Gardner, 2005). It has been found up to 1,860 m in Argentina (Eisenberg, 1989) and 1,830 in Ecuador (D. Tirira pers. comm.). The scattered records in the central Amazon are likely a sampling artefact. Occurs up to 1800 m in Central America (Reid 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Chironectes minimus (water opossum or yapok) is native to tropical and subtropical habitats from southern Mexico to Central and South America. It is most common in northern South America, with documented occurrences in Colombia, Ecuador, Peru, Venezuela (rare), Guyana, Suriname, and French Guiana. This species also has been reported in southeastern Brazil, Paraguay, and northeastern Argentina. There are 4 recognized subspecies of Chironectes minimus, each with a relatively distinct geographic range. Chironectes minimus argyrodtes has the northern-most distribution and is found almost exclusively in southern Mexico (just north of Oaxaca), El Salvador and Honduras. The geographic range of C. m. panamensis extends from southern Central America through northwestern coastal countries in South America. Chironectes minimus minimus can be found primarily in northern South America, throughout Venezuela, Columbia and Guiana. Finally, the geographic distribution of C. m. bresslaui includes southern Brazil, Paraguay, and northeastern Argentina.

Biogeographic Regions: neotropical (Native )

  • Cuarón, A., L. Emmons, K. Helgen, F. Reid, D. Lew, B. Patterson, C. Delgado, S. Solari. 2010. "Chironectes minimus" (On-line). IUCN Red List of Threatened Species. Version 2010.4. Accessed May 18, 2011 at http://www.iucnredlist.org/apps/redlist/details/4671/0.
  • Marshall, L. 1978. Chironectes minimus. American Society of Mammalogists, 109: 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Water opossums are small, rodent-like marsupials with short grayish-white and brown fur. They range in size from 27 to 40 cm long, with an average of 35 cm, and from 604 to 790 g in weight, with an an average of 697 g. They are sexually dimorphic, with males being larger than females. Their long skinny tails are nearly as long as or longer than their bodies and range in length from 30 to 43 cm. Unlike other opossums, water opossums do not use their tails to climb. Instead, the tail is used as a rudder while swimming. The tail may also be used for carrying or manipulating objects. Other distinguishing features include a unique white stripe above their eyes and beneath their lower jaw. Facial bristles and whiskers under each eye serve as important sensory organs. These tactile hairs aid water opossums in maneuvering through water and sensing nearby predators and potential prey. Their appearance has been described as most similar to gray four-eyed opossums, another member of family Didelphidae.

Water opossums are the only extant aquatic marsupial and are well-adapted to their aquatic habitat. Their streamline body is covered with a water-repellent coat that enhances buoyancy. This allows them to float on the surface of the water and to swim rapidly and efficiently. Virginia opossums, a closely related terrestrial species, are strong but slow swimmers. Lacking the water-repellent coat of water opossums, Virginia opossums must expend greater amounts of energy to keep their body afloat. Water opossums also have broad, webbed hindfeet, which they use to move through the water. THeir forefeet, in contrast, are not webbed but consist of long, naked fingers for catching prey. Padding on soles and palms of both hind- and forefeet are minimal; this has been attributed to its aquatic or soft-substrate habitats, particularly muddy banks of river and streams.

Another aquatic adaptation of water opossums is the presence of a water-proof pouch or sphincter known as the pars pudenda. This organ is essential for the survival of offspring, who remain in the mother's pouch during underwater dives. The pars pudenda creates a water-free environment for young that are not yet weaned. Males also possess this sphincter; however, it does not completely cut off the flow of water through the pouch. Rather, it appears to function only to protect the male genitalia while underwater.

Range mass: 604 to 790 g.

Range length: 30 to 40 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 2.793 W.

  • Hume, I. 1982. Digestive Physiology and Nutrition of Marsupials. Great Britan: Cambridge University Press.
  • McLean, R. 1993. A first record of the water opossum Chironectes minimus from Guatemala. The Southwestern Naturalist, 38: 402-404.
  • Nowak, R., D. Wilson. 1999. Walker's Mammals of the World. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Nocturnal; terrestrial and semi aquatic; solitary; it is carnivorous, eating small fish, crabs, crustaceans, insects that it catches in the water, and occasionally frogs. Prey is captured with either the front feet or the mouth. This is confined to areas of permanent water such as streams or rivers, usually within a forest. It is an excellent swimmer and diver, paddling with its hind feet and using its tail as a rudder, and the eyes and top of the head just above water. The den is usually a subterranean cavity, reached through a hole in the stream bank just above water level. Found in tropical forests and cleared areas in tropical forest regions. Most records are from clear rivers, lakes, and streams in hilly areas; may be rare or absent from silt-laden lowland watercourse. Litter size is one to five, with two to three most common. The female keeps the young in her pouch when she swims. In captivity one female had her first oestrous cycle at ten months of age. Within this cavity it builds a nest; in captivity animals have been observed to transport nesting material with their tails (Emmons and Feer, 1997; Marshall, 1978).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Water possums are found most often in semi-aquatic or aquatic habitats, particularly in freshwater streams and near-shore lakes associated with tropical or subtropical forests. Preferred habitat ranges from 0 to 1860 m above sea level. They have relatively elaborate dens that descend into the ground at a 45 degree angle from the entrance, tunneling about 0.6 m in length until reaching a nest area. Dens are constructed just above water level within stream banks and are found in moderately dense cover and cleared tropical forest areas, often between tree roots or in small holes adjacent to water. Burrows are relatively large, and can sustain low levels of water. Diurnal nests are sometimes built near dens in areas of low light, and used as resting spots; these nests are located on the ground composed of gathered grasses and leaves. Water opossums avoid defecating in or near their nesting site, possibly to deter predation since they reside next to commonly visited water sources.

Range elevation: sea level to 1,860 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; mountains

Other Habitat Features: riparian

  • Elliot, D. 1904. The Land and Sea Mammals of Middle America and the West Indies. Chicago: Field Columbian Museum.
  • Marshall, L. 1977. First pliocene record of the water opposum, Chironectus Minimus (Didelphidae, Marsupialia). Journal of Mammalogy, 58: 434-436.
  • Zetek, J. 1930. The Water Opossum: Chironectes Panamensis Goldman. Journal of Mammalogy, Vol.11: 470-471. Accessed April 16, 2011 at http://www.jstor.org/stable/1373967.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Chironectes minimus is carnivorous, typically foraging near fresh water streams, lakes, and rivers to feed on a variety of aquatic organisms. It has also been observed at high elevations trailing rivers along mountains. Prey consists primarily of crustaceans, but also includes aquatic insects and frogs. It also consumes oil producing prey that help maintain its waterproof coat. In addition, C. minimus has been observed feeding on fruits and various aquatic plants when other food sources are limited. Chironectes minimus often displays aggressive behaviors when feeding, and tends to consume large quantities of food. In terrestrial habitats, it sits on its hind legs, rapidly and aggressive tearing food with its sharp teeth. Similar to sea otters, C. minimus secures hard-bodied crustacean prey on its abdomen and cracks open the hard exoskeleton.

Animal Foods: amphibians; fish; insects; aquatic crustaceans

Plant Foods: leaves; fruit; macroalgae

Primary Diet: carnivore (Eats non-insect arthropods); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Chironectes minimus is an important predator of aquatic prey, including aquatic insects and insect larvae. As a result, this species may help control insect pest populations throughout their geographic range. They also create dens and nest that are used by other water opossums once they are abandoned. There is no information available regarding parasites specific to this species.

Ecosystem Impact: creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There is little information available regarding predators specific to Chironectes minimus. Tortato (2009) reported a single predation event by a roadside hawk in Brazil. Chironectes minimus also has been reported in the diet of large eagles such as hawk-eagles, however, these birds relatively rare within C. minimus habitat and likely have little impact on overall population. Wild cats such as ocelots, jaguars, pumas and jaguarundis likely prey on C. minimus as well. Its nocturnal lifestyle and borrowing tendencies likely help reduce risk of predation.

Known Predators:

  • Fleck, D. 1995. Ecology of marsupials in two Amazonian rain forests in northeastern Peru. Journal of Mammology, 76: 809-819.
  • Smith, P. 2007. "Species Account Chironectes minimus" (On-line). FAUNA Paraguay: Online Handbook of Paraguayan Fauna Mammal. Accessed May 19, 2011 at http://www.faunaparaguay.com/chiminhb.html.
  • Tortato, M. 2009. Predation on water opossum (Chironectes minimus) by roadside hawk (Rupornis magnirostris). Mastozoología Neotropical, 16/2: 491-493.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Water opossums are nocturnal and semi-aquatic and use tactile, auditory, and olfactory senses for foraging and reproduction. Their sensitive ears and whiskers are important in detecting prey in the dark and in water. Water opossums are solitary animals, with little intraspecific interaction among conspecifics. During mating season, however, both sexes use pheromones to attract potential mates.

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is no information available regarding the average lifespan of water opossums in the wild. However, gray four-eyed opossums have a mean lifespan of 2 years in the wild. In captivity, water opossums have been reported to live 1 to 3 years. The oldest known specimen lived for 2 years and 11 months.

Range lifespan

Status: captivity:
3 (high) years.

Typical lifespan

Status: captivity:
1 to 3 hours.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 3.1 years (captivity) Observations: Among all the members of the didelphid family, this species seems to be the one that develops more rapidly. One captive specimen lived for 3.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Chironectes minimus is polygynandrous and females are polyestrous, as reproductive females can reproduce more than once in a single breeding season. Females breed up to 2 to 3 times per breeding season. The species as a whole shows precopulatory behaviors, with males and females developing strong social bonds. When mating occurs, males pull females close prior to mounting. When females are carrying offspring, males often circle them as a means of defense.

Mating System: polygynandrous (promiscuous)

Like most mammals, Chironectes minimus is viviparous, with internal fertilization. Breeding season varies geographically. In Brazil, breeding occurs from December through February. In Venezuela, breeding occurs during January, November and July, and in Argentina, breeding occurs during the month of August. An average litter consists of 3 to 4 offspring. Immediately after parturition, neonates climb to the mother's pouch, where they begin nursing. Within the first 38 days offspring develop fur, pigmentation, and their eyes begin to open. By the time young open their eyes, they are too large to remain in the mother's pouch but continue to nurse. Offspring become independent between 45 and 60 days after birth, but maintain a close social bond with their mother.

Breeding interval: Chironectes minimus exhibits polyestrus and can breed soon after giving birth.

Breeding season: Breeding season in Chironectes minimus varies geographically but typically occurs during spring and summer.

Range number of offspring: 1 to 5.

Average number of offspring: 3-4.

Range time to independence: 45 to 60 days.

Average time to independence: 53 days.

Average age at sexual or reproductive maturity (female): 304 days or 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 4.

Average age at sexual or reproductive maturity (female)

Sex: female:
304 days.

There is little information available concerning parental care in water opossums. However, they are likely similar to other members of Didelphidae in producing altricial offspring that remain attached to the mother's mammae. In related species, young remain in the mother’s marsupium, where the mammae are located, until they become too large. This usually occurs around day 40, almost immediately after their eyes begin to open. Although young can no longer remain in their mother’s pouch, they continue to nurse as they lack maure teeth for capturing prey. Developing water opossums develop strong social bonds with their mother and young tend to nestle with the female while sleeping and sometimes climb on their mother's back for transportation. There is no information available regarding paternal care. In gray four-eyed opossums, a closely related species, females leave young unattended for up to two weeks as they forage for food, suggesting little to no paternal investment in young.

Parental Investment: altricial ; female parental care ; pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Male)

  • Cuarón, A., L. Emmons, K. Helgen, F. Reid, D. Lew, B. Patterson, C. Delgado, S. Solari. 2010. "Chironectes minimus" (On-line). IUCN Red List of Threatened Species. Version 2010.4. Accessed May 18, 2011 at http://www.iucnredlist.org/apps/redlist/details/4671/0.
  • Galliez, M., M. de Souza Leite, T. Lopes Queiroz, F. Antonio dos Santos Fernandez. 2009. Ecology of the water opossum Chironectes minimus in Atlantic forest streams of southeatern Brazil. Journal of Mammalogy, 90/1: 93-103.
  • Julien-Laferriere, D., M. Mtramentowicz. 1990. Feeding and Reproduction of Three Dielphid Marsupials in Two Neotropical Forests (French Guiana). Biotropica, 22: 404-415. Accessed April 17, 2011 at http://www.jstor.org/stable/2388558.
  • Marshall, L. 1978. Chironectes minimus. American Society of Mammalogists, 109: 1-6.
  • Marshall, L. 1977. First pliocene record of the water opposum, Chironectus Minimus (Didelphidae, Marsupialia). Journal of Mammalogy, 58: 434-436.
  • Nowak, R., D. Wilson. 1999. Walker's Mammals of the World. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chironectes minimus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTATTATTTGGGGCCTGAGCAGGCATAGTAGGTACTGCTCTAAGCCTTCTTATCCGAGCAGAGCTAGGTCAACCAGGTACTCTTATTGGAGACGACCAAATTTATAATGTAATCGTTACTGCCCATGCTTTTATTATAATTTTCTTCATAGTCATACCTATTATAATTGGAGGTTTTGGTAATTGACTTGTGCCACTTATAATTGGAGCCCCCGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTCCTACCCCCATCATTTCTATTATTATTAGCATCTTCAACCATTGAAGCAGGAGCTGGAACAGGATGAACAGTATATCCTCCATTAGCAGGTAATTTAGCCCATGCAGGAGCTTCAGTTGATTTAGCTATTTTTTCCCTACATCTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTCATTACTACTATTATTAATATAAAACCCCCTGCCATATCTCAATATCAAACACCCTTATTCGTTTGATCCGTAATAATTACAGCAGTTCTCCTTCTTCTATCTCTTCCAGTTTTAGCTGCAGGAATTACTATACTTCTCACAGACCGAAATCTTAATACTACCTTTTTTGACCCTGCTGGAGGAGGTGACCCAATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chironectes minimus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Cuarón, A.D., Emmons, L., Helgen, K., Reid, F., Lew, D., Patterson, B., Delgado, C. & Solari, S.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, occurrence in a number of protected areas and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. Populations of this species are threatened by deforestation, contamination and deterioration of freshwater ecosystems.

History
  • 1996
    Lower Risk/near threatened
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although populations of Chironectes minimus are currently in decline, the IUCN Red List of Threatened Species classifies it as a species of least concern. This species is widely distributed and locally abundant. Currently, there are no major threats to the long-term survival of this species. However, potential threats include deforestation, water pollution or contamination, and habitat deterioration, particularly in freshwater ecosystems. Declines of freshwater invertebrate prey due to deforestation and pollution could also be a point of concern in the near future. It is uncertain whether this species is rare, or if it is infrequently encountered due to its nocturnal lifestyle and use of relatively inaccessible habitats.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Nowak, R. 1999. Walker's Mammals Of The World. Baltimore: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species seems to be common where it occurs, but absent from many regions (Emmons and Feer, 1997). This species is rare in Venezuela, although some authors think that the species is only rarely encountered due to nocturnal habits and inaccessible habitats (Marshall, 1978). Others believe that C. minimus is rare in all areas except Central American river systems (Emmons and Feer 1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats. This species was formerly captured for its skin, although the demand for marsupial furs has subsided in recent years (Eisenberg, 1993). Requires forest and water courses, cannot occur where this habitat is degraded or destroyed. Artisanal gold-mining in French Guiana and other parts of the species' range might degrade water courses posing a serious threat (Catzeflis in litt., 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is found in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Chironectes minimus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Chironectes minimus is hunted by humans for its waterproof fur. Although its skin has little value in most countries, there is an increasing demand in parts of Peru.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Water opossum

The water opossum (Chironectes minimus), also locally known as the yapok /ˈjæpɒk/, is a marsupial of the family Didelphidae. It is the only member of its genus, Chironectes. This semiaquatic creature is found in and near the freshwater streams and lakes in Mexico, Central and South America to Argentina, and is the most aquatic living marsupial (the lutrine opossum also has aquatic habits). It is also the only living marsupial in which both sexes have a pouch. The thylacine, commonly referred to as the Tasmanian tiger, also exhibited this trait, but is now believed to be extinct.[citation needed]

The animal lives in bankside burrows, emerging after dusk to swim and search for fish, crustaceans and other aquatic animals, which it eats on the bank.

Origin of the name[edit]

The local name for the water opossum, "yapok", probably comes from the name of the Oyapok River in French Guyana.

The yapok of Central and South America is superbly adapted to a life in water. It has long webbed toes on its hindfeet,water-repellant fur, and a pouch that closes during dives. It hunts its aquatic prey of fish, frogs, crustaceans, and rests in a riverbank den by day.

Physical appearance[edit]

The yapok is a small opossum, 27-32.5 cm long, with a 36–40 cm long tail. The fur is in a marbled grey and black pattern while the muzzle, eyestripe, and crown are all black. A light band runs across the forehead anterior to the ears, which are rounded and naked. There are sensory facial bristles in tufts above each eye as well as whiskers. The animal's tail, furred and black at the base, is yellow or white at its end. The hindfeet of the yapok are webbed, while the forefeet ("hands") are not. The forefeet can be used to feel for and grab prey as the yapok swims, propelled by its tail and webbed back feet.

Aquatic adaptations[edit]

The water opossum has several adaptations for its watery lifestyle. It has short, dense fur which is water-repellent. The broad hindfeet are webbed and are used for propulsion through water, moving with alternate strokes. They are symmetrical as well, which distributes force equally along both borders of the webbing; this increases the efficiency of the water opossum's movement through the water. The yapok's long tail also aids in swimming.

Being a marsupial and at the same time an aquatic animal, the water opossum has evolved a way to protect its young while swimming. A strong ring of muscle makes the pouch (which opens to the rear) watertight, so the young remain dry, even when the mother is totally immersed in water. The male also has a pouch (although not as watertight as the female's), where he places his genitalia before swimming. This is thought to prevent it from becoming tangled in aquatic vegetation and is probably helpful in streamlining the animal as well.

Reproduction[edit]

Yapoks mate in December and a litter of 1-5 young is born 27 weeks later in the nest. By 22 days the offspring are beginning to show some fur, and by 40 days or so their eyes are open, their bodies protruding from the mother's pouch. At 48 days of age, the young opossums detach from the nipples but still nurse and sleep with the mother.

Fossil record[edit]

The water opossum seems to have a history dating as far back as to the Pliocene epoch.

Holocene subfossil fragments of Chironectes have been discovered in São Paulo, Brazil. Also, there are fossil specimens from the late Pleistocene-Recent cave deposits in Minas Gerais, Brazil as well as from the late Pliocene in Entre Ríos Province, Argentina.

Subspecies[edit]

References[edit]

  1. ^ Cuarón, A. D., Emmons, L., Helgen, K., Reid, F., Lew, D., Patterson, B., Delgado, C. & Solari, S. (2008). Chironectes minimus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!