Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Description

No species has contributed more to the misunderstanding and fear of bats than the vampire bat (4). Public perception and movie portrayal of them as huge, creepy, blood-sucking killers is sensationalist and incorrect. The common vampire bat in fact rarely kills its prey and is relatively small and ordinary looking, although it does possess some fascinating adaptations to its specialized feeding behaviour (5). The thin, pointed, blade-like incisors are so sharp that the victim seldom notices the incision into its flesh (6). Heat sensors on their nose are also an adaptation to help the vampire bat find a good spot on an animal's body to feed (5). Strong hind legs and a special thumb help the bat to climb around on its prey and to take off after feeding (5) (7). The coat is dark greyish-brown, paler on the stomach and females are usually larger than males (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Much of the behavior exhibited by common vampire bats revolves around their feeding habits of drinking blood from birds and mammals, preferentially livestock due to their abundance (2) (7). A common vampire bat finds its prey with echolocation, smell, sound, and possibly heat; it then uses special heat sensors in its nose to find veins that are close to the skin (3). These bats do not actually suck blood from their host, but rather make a small incision and lap up the blood (8), with an anticoagulant in their saliva preventing the blood from clotting (9). Vampire bats live in large colonies in which there are groupings of 8 to 12 females that roost close together on a regular basis, and single males roosting separately, defending territories (2) (3). Within these smaller female groups individuals exhibit a rare example amongst animals of reciprocal altruism, involving a remarkable blood-sharing behaviour in which well-fed bats regurgitate blood to hungry companions (3). Individuals are not always successful in hunting, and hungry bats may starve to death within three days (4). Studies indicate that females will regurgitate to related and unrelated bats within the group, demonstrating a mutual 'buddy system', with pairs of bats forming tight blood-sharing relationships (3). Associations between females are maintained over many years (2), and partner fidelity appears to be central to the persistence of this amazing reciprocal-exchange system (4). Common vampire bats mate year round, with birth peaks during April and May and in October and November (7). Most females have one pregnancy per year, although more than one is possible (2), and single offspring are usual (7). The gestation period is about seven months (2), and pups are born with their eyes open (7). The mother nurses the pup for the first two months (7), introducing regurgitated blood meals to them during their second month, and at four months the pup leaves the nest to accompany its mother on hunts (2). A common vampire bat lives up to 12 years in the wild (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Uruguay, Northern Argentina, Paraguay, Bolivia, and Northern Chile north to Sonora, Nuevo León and Tamaulipas (Mexico); Margarita Island (Venezuela); Trinidad (Simmons 2005). Also Uruguay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The common vampire bat is found from Mexico to Argentina and Chile.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Turner, D. 1975. The Vampire Bat, A Field Study in Behavior and Ecology. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The common vampire bat ranges from northern Mexico through Central and South America to central Chile in the west and Uruguay in the east (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Desmodus rotundus has grayish-brown fur which is lighter on the ventral side. The muzzle is compact and looks swollen, and the ears are pointy. The wing span averages 350-400mm and the head and body length is usually 70-90mm. The common vampire bat has no tail and the membrane between the hind legs, called the uropatagium, is reduced. Females are usually larger than males.

The common vampire bat is highly adapted for its specialized feeding behavior. The braincase is large and the rostrum is reduced to accomodate large razor-sharp incisors and canines. There are two lateral grooves in the tongue that expand and contract as the bat feeds. Desmodus rotundus has an acute sense of smell and large eyes.

The limbs are also specialized. The thumb of the wing is long and well developed, and the hind legs are strong.

Range mass: 15 to 50 g.

Range length: 70 to 90 mm.

Range wingspan: 350 to 400 mm.

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.194 W.

  • Altenbach, J. 1979. Locomotor Morphology of the Vampire Bat, Desmodus rotundus. Pennsylvania: Special Publications 6, The American Society of Mammalogists.
  • Macdonald, D. 1984. Encyclopedia of Mammals. New York: Facts on File.
  • Walker, E. 1975. Mammals of the World, 3rd Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found in large colonies. Hematophagous. Common vampire bats are limited to warm climates. They can be found in both arid and humid parts of the tropics and subtropics. They occur up to 2400 meters in elevation (Ramirez, pers. comm.). The bats usually live in colonies ranging from 20 to 100 individuals although much larger colonies (up to 5,000) have been reported. Desmodus rotundus roosts in moderately lighted caves with deep fissures, and in tree hollows. Vampire bats can also be found in old wells, mine shafts, and abandoned buildings. Roosts often smell strongly of ammonia because of the digested blood that has collected in the crevices and on the floors of the roosts (Mulheisen and Anderson 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common vampire bats are limited to warm climates. They can be found in both arid and humid parts of the tropics and subtropics. They occur up to 2400 meters in elevation (Dr. A. Ramirez, National Coordinator Rabies Program, México, pers. comm.). The distribution is thought to approximate the extent of the 10 degree minimal isotherm for January.

The bats usually live in colonies ranging from 20 to 100 individuals although much larger colonies (up to 5,000) have been reported. Desmodus rotundus roosts in moderately lighted caves with deep fissures, and in tree hollows. Vampire bats can also be found in old wells, mine shafts, and abandoned buildings. Roosts often smell strongly of ammonia because of the digested blood that has collected in the crevices and on the floors of the roosts.

Range elevation: 2400 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Other Habitat Features: caves

  • Brass, D. 1994. Rabies in Bats, Natural History and Public Health Implications. Ridgefield, Connecticut: Livia Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in arid and humid parts of the tropics and subtropics, occupying rainforests as well as deserts, making its home in caves, mines, tree hollows and occasionally abandoned buildings (1) (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Desmodus rotundus feeds exclusively on the blood of other vertebrates. The species is an obligate parasite. In the wild, the bats feed preferentially on livestock because of their abundance, but also prey on wild animals and humans. In captivity, these bats have also been known to feed on snakes, lizards, toads, crocodiles, and turtles.

Animal Foods: blood

Primary Diet: carnivore (Sanguivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Vocalizations are most common between mother and offspring. Small contact cries have been heard from the offspring at 6-12kHz. These usually occur during food sharing. Contact calls are also given when the offspring is trying to find its mother. Chemical cues and touch are also likely to play an important role in communication.

Vampire bats use echolocation and vision to navigate and find prey. They may also use olfaction and auditory cues to identify prey.

Communication Channels: tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic ; echolocation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The life span of vampire bats may be as long as 12 years.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Sex: female

Status: captivity:
19.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 29.2 years (captivity) Observations: They stop growing at about 5 months. One captive specimen lived for 29.2 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males compete for space in roosting places containing females. When more than one male occupies a roost, each defends a small part of the roost from other males. Wilkinson observed resident males in tree roosts actively defending their territory from other wandering males. Defense often includes chasing, pushing, and fighting. Fighting consists of gesturing, striking with the wings, and biting.

Mating behavior begins with a male climbing onto a female's back, grasping her folded wings with his wings, and holding the back of her neck in his mouth. Copulation lasts three to four minutes.

Mating System: polygynous

Desmodus rotundus is believed to be sexually active throughout the year. Although young may be born at any time during the year, peak times for births occurred during April and May and in October and November. A higher number of pregnant females were seen during the rainy season in Mexico and Costa Rica. Most females have one pregnancy per year, but it is possible to have more than one pregnancy in a year. The gestation period is about seven months. Usually only a single young is born, but occasionally there are twins. The newborns are well developed and weigh between five and seven grams at birth. For the first month, the young feed strictly on the mother's milk. Their weight doubles during this time. The young are introduced to blood meals by receiving regurgitated blood from the mother during the second month of life and they accompany their mothers on hunts when they are four months old. The rapid growth is complete in five months.

Breeding interval: Most female vampire bats give birth to one young each year.

Breeding season: lthough young may be born at any time during the year, peak times for births occurred during April and May and in October and November.

Range number of offspring: 2 (high) .

Average number of offspring: 1.

Average gestation period: 7 months.

Average weaning age: 1 months.

Average time to independence: 5 months.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 8 g.

Average gestation period: 189 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
285 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
285 days.

  • Lord, R. 1992. Seasonal reproduction of vampire bats and its relation to seasonality of bovine rabies. Journal of Wildlife Diseases, 28 (2): 292-294.
  • Turner, D. 1975. The Vampire Bat, A Field Study in Behavior and Ecology. Baltimore and London: The Johns Hopkins University Press.
  • Wilkinson, G. 1985. The social organization of the common vampire bat. Behavioral Ecology and Sociobiology, 17 (2): 111-122.
  • Wilkinson, G. 1986. Social grooming in the common vampire bat, Desmodus rotundus. Animal Behaviour, 34 (6): 1880-1889.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Ion channels detects heat: vampire bat
 

'Pit organs' around the nose of vampire bat detects infrared radiation using ion channels.

   
  "Histological studies of the bats'  facial structures indicate that thermal stimuli are most probably  perceived in the three pits surrounding the central nose leaf: the thin,  hairless and glandless skin is underlaid with dense connective tissue.  Thermography reveals that the surface temperature of the nasal region is  up to 9°C lower than that of the neighboring parts of the face (Fig.  2)." (Kürten and Schmidt 1982:223)


"Vampire bats (Desmodus rotundus) are obligate blood feeders that have evolved specialized systems to suit their sanguinary lifestyle.  Chief among such adaptations is the ability to detect infrared  radiation as a means of locating hotspots on warm-blooded prey. Among  vertebrates, only vampire bats, boas, pythons and pit vipers are capable  of detecting infrared radiation.  In each case, infrared signals are detected by trigeminal nerve fibres  that innervate specialized pit organs on the animal’s face.  Thus, vampire bats and snakes have taken thermosensation to the extreme  by developing specialized systems for detecting infrared radiation. As  such, these creatures provide a window into the molecular and genetic  mechanisms underlying evolutionary tuning of thermoreceptors in a  species-specific or cell-type-specific manner(...)Here we show that vampire bats tune a channel* that is already  heat-sensitive, TRPV1, by lowering its thermal activation threshold to  about 30°C. This is  achieved through alternative splicing of TRPV1 transcripts to produce a  channel with a truncated carboxy-terminal cytoplasmic domain. These  splicing events occur exclusively in trigeminal ganglia, and not in  dorsal root ganglia, thereby maintaining a role for TRPV1 as a detector  of noxious heat in somatic afferents." (Gracheva et al. 2011:88)

*Ion channels are pore-forming proteins that regulate the flow of ions across the membrane in all cells.

The channel acts like a little thermostat. "Altering its structure by leaving out part of the gene tunes the  ability of the channel to detect heat. By expressing different forms in  different tissues, the bats have split the function of the sensor,  maintaining its original function but also gaining the ability to  detect body heat for more efficient hunting." (Wigmore 2011)

  Learn more about this functional adaptation.
  • Kürten, L.; Schmidt, U. 1982. Thermoperception in the common vampire bat (Desmodus rotundus). Journal of Comparative Physiology A: Sensory, Neural, and Behavioral Physiology. 146(2): 223-228.
  • Gracheva EO; Cordero-Morales JF; González-Carcacía JA; Ingolia NT; Manno C; Aranguren CI; Weissman JS; Julius D. Ganglion-specific splicing of TRPV1 underlies infrared sensation in vampire bats. Nature. 476: 88–91.
  • Wigmore G. 2011. Vampire bats turn down the heat sensors to hunt. NatureNews [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Concentrating blood lightens weight: vampire bats
 

The digestive and circulatory systems of vampire bats lighten their load after ingesting a large volume of blood by rapidly concentrating the blood and excreting the water content.

   
  "[Bat] stomachs can hold a volume of blood equal to 57 percent of their body mass, but they can't fly with this much extra weight. The problem is solved by rapidly getting rid of water and lightening their load before taking off. Within two minutes after a bat begins to feed, it begins to excrete a stream of very dilute urine." (Crump 2005:68)
  Learn more about this functional adaptation.
  • Crump, M. 2005. Headless Males Make Great Lovers & Other Unusual Natural Histories. Chicago, IL: University of Chicago Press. 199 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Tissue slices go undetected: vampire bat
 

The teeth of vampire bats cut into flesh painlessly because they are razor-sharp.

   
  "It sinks its razor-sharp teeth into the skin, scoops out a sliver of flesh, and inserts its tongue into the wound…The bite causes little pain, and the animal rarely awakens." (Crump 2005:68)
  Learn more about this functional adaptation.
  • Crump, M. 2005. Headless Males Make Great Lovers & Other Unusual Natural Histories. Chicago, IL: University of Chicago Press. 199 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Desmodus rotundus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 107
Specimens with Barcodes: 178
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Desmodus rotundus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 139 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACATAATGTTCGGGGCCTGAGCTGGCATGGTGGGGACCGCACTCAGCCTGCTCATTCGGGCTGAGCTCGGCCAGCCAGGGGCTCTTTTAGGCGATGACCAGATCTATAATGTAGTAGTAACAGCCCATGCTTTCGTAATAATCTTTTTCATAGTAATGCCAATTATGATCGGGGGCTTCGGCAACTGACTAGTTCCCCTAATAATCGGCGCCCCTGACATGGCCTTCCCCCGAATAAACAACATGAGCTTTTGACTTTTACCTCCCTCATTCCTACTCCTGCTTGCCTCCTCAACAATTGAAGCAGGCGTTGGCACCGGCTGAACTGTCTACCCCCCTTTAGCGGGAAACCTGGCCCATGCCGGTGCCTCCGTAGACCTAGCAATCTTCTCCCTCCACCTCGCGGGCGTATCCTCTATCCTAGGGGCTATTAACTTCATTACGACCATCATCAATATGAAGCCCCCAGCCACCTCCCAATACCAAACACCCTTATTTGTCTGATCCGTTCTAATCACAGCAGTACTACTACTGCTTTCTCTCCCTGTTCTTGCGGCCGGCATCACCATACTATTGTCAGACCGAAATCTAAACACAACTTTCTTTGACCCCGCTGGAGGAGGAGACCCTATCCTATACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Barquez, R., Perez, S., Miller, B. & Diaz, M.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population tolerance of a degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vampire bat populations have increased because of the introducion of livestock in South America, providing an abundant new source of food.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Lower Risk/least concern (LR/lc) on the IUCN Red List 2004 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant. This bat is a social animal that hunts and lives in groups. The bats live in colonies consisting of both males and females. In captivity, dominance hierarchies based on access to food were observed, but there is little conclusive evidence of complex hierarchies in the wild. Curiously, most close associations are formed between several females or females and their offspring; adult males do not form close social ties in the roost. Females frequent more roost site than males, making associations in many different places. The associations between females are maintained over many years. Wilkinson (1985, 1986) reported that although self-grooming occurs more often, social grooming is an important part of the vampire bat's behaviour. Social grooming usually occurs between females and their offspring, but it is also significant between adult females. The adult females participating in grooming are usually closely related or roost mates. Wilkinson (1986) found that social grooming has more to do with food sharing than with the removal of ectoparasites. In many instances, social grooming begins with one female approaching another and grooming her for as long as two minutes. The female being groomed then regurgitates part of her blood meal for the grooming female. It is also common to see females regurgitate food for their offspring.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is persecuted due to rabies but this is not a major threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The common vampire bat is one of the few bat species that are considered an agricultural pest, due to its feeding on livestock and spreading of diseases, which has resulted in rabies outbreaks in cattle (1) (10). Recent incidents of vampire bats attacking humans in Peru, Brazil and El Salvador have also attracted world-wide press interest, compounding the species' already negative and misunderstood public perception (1). The result has been wide-scale eradication programmes, particularly in ranching areas, with control methods including burning, gassing and dynamiting of potential roosts (1) (10). Fortunately, the common vampire bat is not considered threatened, but vampire bat control programmes have nevertheless had a considerable impact (1), especially on other helpful, fruit-eating bats that are destroyed by people who mistake them for vampires (10). One control programme in Venezuela reportedly destroyed 40,000 caves, resulting in the loss of large populations of harmless bats as well as other cave fauna (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There is a need for building human resource capacity for colonies elimination.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The management and conservation of vampire bats was discussed in depth at the 11th International Bat Research Conference held in Brazil in August 1998, attended by bat researchers and public health and veterinary officers. Conservation initiatives so far have included education programmes, such as a video programme developed by Bat Conservation International in the United States, and a range of other local and national educational and training efforts. The development of immunisation techniques has also been advocated as a potential conservation action for the future, involving oral vaccinations for the localised control of rabies in vampire bats. Additionally, it has been suggested that more targeted, non-chemical methods for the control of these bats are developed, which do not needlessly harm other species (1). Although the problems common vampire bats cause certainly need to be addressed, it is important that work is also done to dispel the animal's undeserving negative reputation, since such unfounded prejudice could unfairly influence the treatment of this fascinating, unique and highly specialised species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

A bite from Desmodus rotundus can cause infections and transmit diseases carried by the bat. Infections can spread rapidly and cause death. The vampire bat transmits rabies to both humans and domestic livestock. Losses to the cattle industry in Latin America amount to many millions of dollars every year.

Negative Impacts: injures humans (bites or stings, carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Research on the anticoagulant agents in vampire bat saliva may improve medical treatment of some human injuries and diseases. Guano can be harvested and used as a fertilizer.

Positive Impacts: source of medicine or drug ; research and education; produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common vampire bat

The common vampire bat (Desmodus rotundus) is a small, leaf-nosed bat native to the Americas. It is one of three extant species of vampire bat, the other two being the hairy-legged and the white-winged vampire bats. These species are the only parasitic mammals. The common vampire bat mainly feeds on the blood of livestock, approaching its prey at night while they are sleeping. It uses its razor-sharp teeth to cut open the skin of its hosts and laps up their blood with its long tongue.

The species is highly polygynous, and dominant adult males defend harems of females. It is one of the most social of bat species with a number of cooperative behaviors such as alloparenting, social grooming and food sharing. Because it feeds on livestock and is a carrier of rabies, the common vampire bat is considered a pest. Its conservation status is categorized as Least Concern by the International Union for Conservation of Nature (IUCN) because of "its wide distribution, presumed large population tolerance of a degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category."[1]

Taxonomy[edit]

The common vampire bat was first classified as Phyllostoma rotundum by Étienne Geoffroy Saint-Hilaire in 1810.[2] The species received several scientific names before being given its current one—Desmodus rotundus—by Oldfield Thomas in 1901.[2] It is classified under the subfamily Desmodontinae along with two other species: the hairy-legged vampire bat (Diphylla ecaudata), and the white-winged vampire bat (Diaemus youngi). These three species compose the "true" vampire bats, as opposed to the "false" vampires of the family Megadermatidae and the spectral bat. All three species of Desmodontinae specialize in feeding on the blood of warm-blooded animals.[3] However, the common vampire bat feeds on mammalian blood more than the other two species, which primarily feed on that of birds.[4][5] The three species resemble each other, but the common vampire bat can be distinguished by its longer thumb.[4] It is the only extant member of its genus, although other fossil species have been described.[2]

Physical description[edit]

A vampire bat skull, showing the distinctive incisors and canines

The common vampire bat is short-haired, with silver-gray fur on its undersides, sharply demarcated from the darker fur on its back.[2] It has small, somewhat rounded ears, a deeply grooved lower lip, and a flat, leaf-shaped nose.[2] A well-developed, clawed thumb on each wing is used to climb onto prey and to assist the animal in take-off.[2] The bat averages about 9 cm (3.5 in) long with a wingspan of 18 cm (7 in). It commonly weighs about 57 grams (2 oz), but its weight can double after a single feeding.[6] The braincase is relatively large, but the snout is reduced to accommodate large incisors and canines.[2] It has the fewest teeth among bats. The upper incisors lack enamel, which keeps them razor-sharp.[2] Common vampire bats exhibit sexual dimorphism in which females are bigger than males.[7]

While most other bats have almost lost the ability to maneuver on land, vampire bats are an exception.[8] They can run using a unique, bounding gait in which the forelimbs are used instead of the hindlimbs to propel forward, as the wings are much more powerful than the legs.[8] This ability likely evolved independently within the bat lineage.[8] Three pads under the thumb function like a sole.[2] It is also capable of leaping in various directions, magnitudes and temporal sequences.[9] When making a jump, the bat pushes up with its pectoral limbs. The hindlimbs keep the body over the pectoral limbs which are stabilized by the thumbs.[10]

Common vampire bats have good eyesight. They are able to distinguish different optical patterns and may use vison for long-range orientation.[2] These bats also have well-developed senses of smell and hearing: the cochlea is highly sensitive to low-frequency acoustics, and the nasal passages are relatively large.[2] They emit echolocation signals orally, and thus fly with their mouths open for navigation.[11] They can identify a metal strip 1 centimetre (0.39 in) wide at a distance of 50 centimetres (20 in), which is moderate compared to other bats.[11]

Range and habitat[edit]

The common vampire bat is found in parts of Mexico, Central America, and South America.[2] They can be found as far north as 280 kilometres (170 mi) south of the US border. Fossils of this species have been found in Florida and states bordering Mexico. The common vampire is the most common bat species in southeastern Brazil.[12] The southern extent of its range is Uruguay, northern Argentina, and central Chile. In the West Indies, the bat is only found on Trinidad. It prefers warm and humid climates,[13][14] and uses tropical and subtropical woodlands and open grasslands for foraging.[3] Bats roost in trees, caves, abandoned buildings, old wells, and mines.[13][15] Vampire bats will roost with nine other bat species, and tend to be the most dominant at roosting sites.[15] They occupy the darkest and highest places in the roosts; when they leave, other bat species move in to take over these vacated spots.

Behavior[edit]

Feeding[edit]

A vampire bat being fed at the Buffalo Zoo

The common vampire bat feeds primarily on mammalian blood, particularly that of livestock such as cattle and horses.[13] Vampire bats feed on wild prey like the tapir, but seem to prefer domesticated animals, and favor horses over cattle when given the choice.[16] Female animals, particularly those in estrus, are more often targeted than males. This could be because of the hormones.[17]

Vampire bats hunt at night,[13] using echolocation and olfaction to track down prey.[18] They feed in a distance of 5 to 8 km (3.1 to 5.0 mi) from their roosts,[19] and leave in an orderly fashion; bachelor males are the first to depart, followed by the females, and finally the harem males.[20] When a bat selects a target, it lands on it, or jumps up onto it from the ground,[13][19] usually targeting the rump, flank, or neck of its prey;[13] heat sensors in the nose help it to detect blood vessels near the surface of the skin.[16] It pierces the animal's skin with its teeth, peels away a small flap,[19] and laps up the blood with its tongue, which has lateral grooves adapted to this purpose.[21] The blood is kept from clotting by an anticoagulant in the saliva.[19] When feeding, the blood is stored in the cardiac notch.[2] Bats feed for 30 minutes and become so swollen with blood, they can barely fly. They must then hide themselves and wait for the blood to digest and some of the water to be excreted before taking off.[13]

Vampire bats commonly return to the same host on consecutive nights, after marking the animal with urine. They are protective of their host and will fend off other bats while feeding.[14][18] It is uncommon for two or more bats to feed on the same host, with the exception of mothers and their offspring.[14][18]

Mating and reproduction[edit]

A male and his females compose a harem. Harems may contain multiple males;[20] in these groups, the males have a dominance hierarchy, and the dominant one mates preferentially with the females of the roost and sires about 50% of the offspring; the next-dominant male fathers the second-most offspring, and so on.[22] Male vampire bats maintain roosting sites that attract or contain females,[22] and harem males are usually the only ones that mate with their females.[13] Bachelor males try to mate with harem females when possible, but the females usually refuse them.[22] In multiple-male harems, a female may reject mating attempts by the dominant male, possibly to avoid inbreeding.[20]

Vampire bats in a crate

During estrus, a female releases one egg.[2] Mating usually lasts three to four minutes; the male bat mounts the female from the posterior end, grasps her back with his teeth, holds down her folded wings, and inseminates her.[21] Vampire bats are reproductively active year around, although the number of conceptions and births peak in the rainy season.[13][19] Females give birth to one offspring per pregnancy,[13][19] following a gestation period of about seven months.[2] The young are raised primarily by the females. Mothers leave their young to hunt, and call their young to feed upon returning.[13] They are given their mother’s milk exclusively for the first three months, and are subsequently fed mixtures of milk and regurgitated blood.[7] The young accompany their mothers to hunt at six months, but are not fully weaned until nine months.[13] Female offspring usually remain in their natal groups into adulthood, unless their mothers die or move.[22] The occasional movements of unrelated females between groups leads to the formation of multiple matrilines within groups.[22] Females are reluctant to join new groups, as a bat's survival rate depends on long-lasting social bonds[16][22]—a female which enters a new group may not be fully accepted.[22] Male offspring tend to live in their natal groups until they are one to two years old, sometimes being forced out by the resident adult males.[22]

Cooperation[edit]

Common vampire bats display a high amount of cooperative behavior. Females in a harem have strong social bonds between themselves that are reinforced through interactions in the roost.[16] A harem male has moderately strong relationships with his females.[23] In harems with multiple males, the males may have mutual bonds, but they are not as strong as those of the females.[18] While the harem male's relationship with outside bachelors males is mostly antagonistic, they are allowed into the harems during low ambient temperatures—possibly a form of social thermoregulation.[7] Bats display reciprocal altruism by sharing food; when a bat is unsuccessful in feeding, it solicits food from a roost-mate[16][18] which regurgitates blood to feed its neighbor.[13][16] This behavior likely evolved to combat starvation,[23] as a bat cannot survive more than three nights without feeding.[16] The females share blood with one another, the harem male shares blood with his females, and harem males may also share food with each other.[23]

Female vampire bats display alloparenting.[16] Lactating females in roosts will feed both young whose mothers have died, and those whose mothers are still alive.[22] This mechanism evolved to keep the young from starving and to ease the burden of raising offspring.[7] Vampire bats also participate in mutual grooming;[18] two bats groom each other simultaneously to clean one another, and to strengthen social bonds.[24] Bats that groom one another also share food. While grooming, a bat can assess the size of its partner’s abdomen to determine if it really needs to eat.[24] Grooming is also dependent on kinship and relatedness.[24] Mothers groom their offspring more than other bats, which may promote mutual recognition.[24]

Relationship with humans[edit]

Taxidermied bat on display

According to the Centers for Disease Control and Prevention, most bats do not have rabies.[25] For example, even among bats submitted for rabies testing because they could be captured, were obviously weak or sick, or had been captured by a cat, only about 6% had rabies.[25] However, of the few cases of rabies reported in the United States every year, most are caused by bat bites.[25]

The highest occurrence of rabies in vampire bats occurs in the large populations found in South America. The danger is not so much to the human population, but rather to livestock.[26] Dr. Joseph Lennox Pawan, a government bacteriologist in Trinidad, found the first infected vampire bat in March 1932.[27] He soon proved various species of bat, including the common vampire bat, are capable of transmitting rabies for an extended period of time without artificial infection or external symptoms.[27] Fruit bats of the Artibes genus were later shown to demonstrate the same abilities. During this asymptomatic stage, the bats continue to behave normally and breed. At first, Pawan's finding that bats transmitted rabies to people and animals were thought fantastic and were ridiculed.[27]

Although most bats do not have rabies, those that do may be clumsy, disoriented, and unable to fly, which makes them more likely to come into contact with humans. There is evidence that it is possible for the rabies virus to infect a host purely through airborne transmission, without direct physical contact of the victim with the bat.[28][29] Although one should not have an unreasonable fear of bats, one should avoid handling them or having them in one's living space, as with any wild animal. Medical attention should be given to any person who awakens to discover a vampire bat in their sleeping quarters. It is possible that young children may not fully awaken due to the presence of a bat (or its bite).[25]

The unique properties of the vampire bats' saliva have found some positive use in medicine. A genetically engineered drug called desmoteplase, which uses the anticoagulant properties of the saliva of Desmodus rotundus, has been shown to increase blood flow in stroke patients.[30]

See also[edit]

References[edit]

  1. ^ a b Barquez, R., Perez, S., Miller, B. & Diaz, M. (2008). "Desmodus rotundus". IUCN Red List of Threatened Species. Version 2010.2. International Union for Conservation of Nature. Retrieved 17 July 2010. 
  2. ^ a b c d e f g h i j k l m n o Greenhall, A.M.; Joermann, G.; Schmidt, U. (1983). "Desmodus rotundus". Mammalian Species 202: 1–6. doi:10.2307/3503895. 
  3. ^ a b Eisenberg, John F; Redford, Kent Hubbard (1992). Mammals of the Neotropics, Volume 3. University of Chicago Press. pp. 187–88. ISBN 0-226-19542-2. 
  4. ^ a b Greenhall, A.M.; Schutt, Jr, W.A. (1996). "Diaemus youngi". Mammalian Species 533: 1–7. doi:10.2307/3504240. 
  5. ^ Greenhall, A.M.; Joermann, G.; Schmidt, U. (1984). "Diphylla ecaudata". Mammalian Species 227: 1–3. doi:10.2307/3504022. 
  6. ^ Common vampire bat Desmodus rotundus Nat Geo Wild. Retrieved 21 August 2008.
  7. ^ a b c d Delpietro V. & Russo, R. G. (2002) "Observations of the Common Vampire Bat and the Hairy-legged Vampire Bat in Captivity", Mamm. Biol, 67:65-78. [1] doi:10.1078/1616-5047-00011
  8. ^ a b c Riskin, Daniel K.; Hermanson, John W. (2005). "Biomechanics: Independent evolution of running in vampire bats". Nature 434: 292. doi:10.1038/434292a. video
  9. ^ Altenbach, J. S. (1979) "Locomotor morphology of the vampire bat, Desmodus rotundus", Special publication (American Society of Mammalogists), no. 6.
  10. ^ Schutt, W.A., Jr.; Hermanson, J.W.; Chang, Y.H.; Cullinane, D.; Altenbach, J.S.; Muradali, F.; Bertram, J.E.A. (1997). "The dynamics of flight-initiating jumps in the common vampire bat Desmodus rotundus". The Journal of Experimental Biology 200 (23): 3003–12. PMID 9359889. 
  11. ^ a b Schmidt U, Schmidt C. (2007). "Echolocation performance of the vampire bat (Desmodus rotundus)". Z Tierpsychol 45 (4): 349–58. PMID 610226. 
  12. ^ Trajano, E. (1996). "Movements of Cave Bats in Southeastern Brazil, With Emphasis on the Population Ecology of the Common Vampire Bat, Desmodus rotundus (Chiroptera)". Biotropica 28 (1): 121–29. JSTOR 2388777. 
  13. ^ a b c d e f g h i j k l m Lord, R. D. (1993) "A Taste for Blood: The Highly Specialized Vampire Bat Will Dine on Nothing Else". Wildlife Conservation 96:32-38.
  14. ^ a b c Wilkinson, G. S. (1985). "The Social Organization of the Common Vampire Bat 1: Pattern and Cause of Association". Behav. Ecol. Sociobiol 17 (1): 111–21. JSTOR 4599814. 
  15. ^ a b Wohlgenant, T. (1994). "Roost Interactions Between the Common Vampire Bat (Desmodus rotundus) and Two Frugivorous Bats (Phyllostomus discolor and Sturnira lilium) in Guanacaste, Costa Rica". Biotropica 26 (3): 344–48. JSTOR 2388857. 
  16. ^ a b c d e f g h Wilkinson. G., (1990) "Food Sharing in Vampire Bats". Scientific American, 262(21):76-82.
  17. ^ Schutt, W.A, Jr.; Muradali, F; Mondol N; Joseph, K; and Brockmann, K. (1999). "Behavior and Maintenance of Captive White-Winged Vampire Bats, Diaemus youngi". Journal of Mammology 80 (1): 71–81. JSTOR 1383209. 
  18. ^ a b c d e f Wilkinson, J. (2001) Bat Blood Donors. (Ed. by D. MacDonald & S. Norris), 766-767. In: The Encyclopedia of Mammals. Facts on File. ISBN 0-87196-871-1
  19. ^ a b c d e f Nowak, R. M. (1991) Walker's Mammals of the World. pp. 1629. John Hopkins Press. ISBN 0-8018-3970-X
  20. ^ a b c Park, S. R. (1991) "Development of Social Structure in a Captive Colony of the Common Vampire Bat", Desmodus rotundus. Ethology 89:335-341. [2] doi:10.1111/j.1439-0310.1991.tb00378.x
  21. ^ a b Anderson, Rebecca, Michael Mulheisen. "Desmodus rotundus". Animal Diversity Web. Retrieved December 16, 2011. 
  22. ^ a b c d e f g h i Wilkinson, G. S. (1985). "The Social Organization of the Common Vampire Bat II: Mating system, genetic structure, and relatedness". Behav. Ecol. Sociobiol 17 (2): 123–34. ISSN 0340-5443. 
  23. ^ a b c DeNault L. K. & MacFarlane, D. (1995). "Reciprocal altruism between male vampire bats], Desmodus rotundus". Anim. Behav 49 (3): 855–56. doi:10.1016/0003-3472(95)80220-7. ISSN 0003-3472. 
  24. ^ a b c d Wilkinson, G. S. (1986) "Social Grooming in the Common Vampire Bat, Desmodus rotundus". Anim. Behav. 34:1880-1889.
  25. ^ a b c d CDC (April 22, 2011). "Learning about bats and rabies". Retrieved 5 December 2011. 
  26. ^ Bat Facts Smithsonian. Retrieved 6 April 2011.
  27. ^ a b c Joseph Lennox Pawan, Caribbean Council for Science and Technology. Retrieved 1 April 2011
  28. ^ Constantine, Denny G. (April 1962). "Rabies transmission by nonbite route". Public Health Reports (Public Health Service) 77 (4): 287–289. doi:10.2307/4591470. PMC 1914752. PMID 13880956. "These findings support consideration of an airborne medium, such as an aerosol, as the mechanism of rabies transmission in this instance." 
  29. ^ Messenger, Sharon L.; Jean S. Smith and Charles E. Rupprecht (2002-09-15). "Emerging Epidemiology of Bat-Associated Cryptic Cases of Rabies in Humans in the United States". Clinical Infectious Diseases 35 (6): 738–747. doi:10.1086/342387. PMID 12203172. "Cryptic rabies cases are those in which a clear history of exposure to rabies virus cannot be documented, despite extensive case‐history investigation. Absence of a documented bite history reflects inherent difficulties in obtaining accurate animal‐contact information.... <gap> Thus, absence of bite-history data does not mean that a bite did not occur." 
  30. ^ Liberatore, G. T., Samson, A., Bladin, C., Schleuning, W., Medcalf, R. (2003). "Vampire Bat Salivary Plasminogen Activator (Desmoteplase) A Unique Fibrinolytic Enzyme That Does Not Promote Neurodegeneration". Stroke 34 (2): 537–43. doi:10.1161/01.str.0000049764.49162.76. PMID 12574572. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!