Tupaia belangeri — Details

Northern Tree Shrew learn more about names for this taxon

Overview

Distribution

Range Description

Learn more about this article

Found in South-east Asia, north of the isthmus of Kra, including: Thailand, Bangladesh, Burma, far north-eastern India and Nepal, southern China, Cambodia, Lao PDR, Viet Nam, and associated coastal islands, including Hainan. It probably also occurs on Preparis Island north of the Andaman Islands (Helgen 2005). Listed as present in Bhutan by Molur et al. (2005). Recorded to 3,000 m in China (E. Smith pers. comm).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology
This widespread species is found in deciduous and evergreen primary forest and secondary forest, commonly in karst and associated natural scrub vegetation, from sea level up to upper montane areas (Molur et al. 2005; W. Duckworth pers. comm.). It is highly adaptable and may be found in oil palm plantations (K. H. Han pers. comm.), coconut plantations (Parr 2003), and regenerating scrub and ruderial mixes above abandoned dry rice fields (W. Duckworth pers. comm.). It has been seen very far from tall forest, and is probably able to live independently of tall forest (such as in far northern Lao PDR; W. Duckworth pers. comm).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Learn more about this article

Maximum longevity: 11.1 years (captivity) Observations: One captive specimen lived for 11.1 years (Richard Weigl 2005). There are anecdotal reports of animals living up to 14 years, but these are unconfirmed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tupaia belangeri

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0102-06|AJ421453|Tupaia belangeri| AACCGTTGATTATTCTCAACCAACCACAAAGATATTGGAACACTGTACTTACTATTTGGTGCTTGAGCCGGAATAGTCGGAACAGCCTTA---AGTCTTCTTATTCGCGCCGAGTTAGGTCAACCTGGGGCCTTGTTAGGTGAT---GATCAGATCTATAATGTCATCGTTACTGCTCACGCATTTGTTATAATTTTCTTTATGGTTATACCTATTATAATCGGAGGGTTTGGAAACTGATTAGTCCCTTTAATA---ATTGGGGCCCCTGATATAGCTTTCCCCCGAATGAATAATATAAGCTTTTGACTCCTCCCTCCTTCATTCCTTCTCCTTTTAGCATCATCAATAGTTGAAGCAGGTGCTGGAACTGGGTGAACTGTATACCCACCATTAGCCGGCAACCTAGCCCACGCGGGCGCTTCAGTCGATCTT---ACAATTTTCTCACTTCATCTTGCCGGGGTATCATCTATCCTAGGAGCAATCAACTTTATTACAACAATTATTAATATAAAACCCCCAGCCATGTCACAATACCAAACCCCATTGTTCGTATGATCAGTCCTTATCACAGCCGTCTTATTACTACTCTCTCTACCCGTTCTAGCAGCA---GGCATTACCATGCTCCTAACCGACCGAAATCTAAACACGACATTTTTCGACCCTGCGGGTGGTGGAGACCCAATCCTCTACCAACACTTGTTCTGATTCTTCGGCCACCCCGAAGTATATATCCTAATCCTACCCGGCTTCGGAATTATCTCCCACATTGTCACCTATTACTCAGGAAAAAAA---GAACCTTTCGGGTACATGGGCATAGTATGAGCAATAATATCCATCGGATTCCTAGGGTTTATCGTATGAGCCCACCATATATTCACAGTTGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Tupaia belangeri

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Han, K.H, Duckworth, J.W. & Molur, S.

Reviewer/s
Hoffmann, M. & Chanson, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in view of its wide range, abundance, tolerance of habitat disturbance, and presence in numerous protected areas.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Population

Learn more about this article

Population
This species is common throughout its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Threats

Threats

Learn more about this article

Major Threats
There are no major known threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
It is found in numerous protected areas throughout its range, such as Kang Kachan National Park (Thailand) and Mehao Wildlife Sanctuary, Namdapha National Park, and Singhalila National Park (India). It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Northern Treeshrew

Learn more about this article

The Northern treeshrew (Tupaia belangeri) is a species of treeshrew found in Southeast Asia.

It was chosen as one of the 16 mammals to have their genomes sequenced by the Broad Institute, and a low coverage assembly of genome was released by the Broad Institute in June 2006. The genome will be useful in comparisons with the other genomes to identify genes.[2] Complete mitochondrial genome data supports the hypothesis that there is a closer phylogenetic relationship of Tupaia to rabbits than to primates.[3]

Adult weight : 0.2 kg (0.44 lbs)

Maximum longevity : 11 years

References

  1. ^ Han, K. H., Duckworth, J. W. & Molur, S. (2008). Tupaia belangeri. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 30 December 2008.
  2. ^ Tree Shrew (Tupaia belangeri)
  3. ^ Jürgen Schmitz, Martina Ohme, and Hans Zischler, The complete mitochondrial genome of Tupaia belangeri and the phylogenetic affiliation of Scandentia to other eutherian orders, Molecular Biology and Evolution 17(9):1334-1343, 2000


Stub iconThis article about a mammal is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!