Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Senometopia pollinosa is endoparasitoid of larva of Thera obeliscata

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thera obeliscata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 30 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATCTGAGCTGGAATAATTGGTACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTAATACTCGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCCTCAATTACTCTCTTAATCTCAAGAAGTATCGTAGAAAATGGAGCTGGGACTGGTTGAACTGTTTACCCTCCTCTTTCATCTAATATTGCCCATGGGGGCAGATCCGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATCAATATACGTTTAAATAATATATTTTTTGATCAATTACCTTTATTTGTTTGAGCTGTTGGAATCACAGCATTTTTACTATTGTTATCTTTACCTGTATTAGCCGGAGCTATTACAATATTATTAACCGATCGAAATTTAAATACATCTTTTTTTGATCCTGCGGGAGGAGGAGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thera obeliscata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 87
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thera obeliscata

The Grey Pine Carpet (Thera obeliscata) is a moth of the family Geometridae. It is found throughout Europe.

The wingspan is 28–36 mm. The moth flies from April to October depending on the location.

The larva primarily feed on Pine and Spruce.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!