Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Senometopia pollinosa is endoparasitoid of larva of Thera obeliscata

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thera obeliscata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 30 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATCTGAGCTGGAATAATTGGTACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTAATACTCGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCCTCAATTACTCTCTTAATCTCAAGAAGTATCGTAGAAAATGGAGCTGGGACTGGTTGAACTGTTTACCCTCCTCTTTCATCTAATATTGCCCATGGGGGCAGATCCGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATCAATATACGTTTAAATAATATATTTTTTGATCAATTACCTTTATTTGTTTGAGCTGTTGGAATCACAGCATTTTTACTATTGTTATCTTTACCTGTATTAGCCGGAGCTATTACAATATTATTAACCGATCGAAATTTAAATACATCTTTTTTTGATCCTGCGGGAGGAGGAGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thera obeliscata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 87
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thera obeliscata

The Grey Pine Carpet (Thera obeliscata) is a moth of the family Geometridae. It is found throughout North and Central Europe East across the Palearctic to Siberia, South to the Caucasus and Transcaucasia.In the Alps it rises to altitudes of over 1500 metres.

The wingspan is 28–36 mm. Forewing reddish brown or fulvous, the distal edge of the median band not strongly indented, or with only one deep indentation (on the fold); pale subterminal line commonly obsolete, or if present, not strongly dentate. Hindwing rather more glossy and brownish than that of Thera variata , the discal dot generally altogether obsolete on the upperside, though expressed beneath. — ab. tristrigaria Donov. is an infrequent aberration with 3 unusually well developed, elongate interneural submarginal streaks between the 5th subcostal and 3rd radial veins. — ab. mediolucens Rossi, is a rather striking form in which the ground-colour is appreciably darkened while the median band remains fulvous, thus appearing lighter, or at least brighter, than the adjoining areas. — ab. obliterata B. White is almost unicolorous brown-black or black-brown Britain and occasionally in the mountains of Central Italy.[1]

The larva primarily feed on [[Scots pine|Pinus sylvestris]] and Picea abies. The species prefers settled pine forests.

References[edit]

  1. ^ Prout , L.B. 1912–16. Geometridae. In A. Seitz (ed.) The Macrolepidoptera of the World. The Palaearctic Geometridae, 4. 479 pp. Alfred Kernen, Stuttgart.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!