Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupithecia nanata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACCTCATTAAGATTACTAATTCGAGCTGAATTAGGTACCCCTGGATCTTTAATTGGAGATGACCAAATTTACAATACTATTGTTACAGCTCACGCATTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAACTGATTAGTGCCTTTAATATTAGGAGCCCCAGATATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGATTATTACCCCCCTCTATTACATTATTAATTTCAAGAAGAATTGTGGAAAATGGAGCCGGAACTGGTTGAACAGTTTACCCCCCTTTATCCTCTAATATTGCTCATGGAGGAAGATCTGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCTTTATTTGTGTGAGCTGTAGGAATTACAGCTTTTTTACTTCTTTTATCTTTACCGGTATTGGCAGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATCTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eupithecia nanata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eupithecia nanata

The Narrow-winged Pug (Eupithecia nanata) is a moth of the family Geometridae. The species can be found all over Europe including Russia (North to Kola Peninsula) and the Ukraine. In the Alps it occurs up to 2200 metres and the Pyrenees to 2400 meters above sea level.The species prefers dry or boggy heathlands.

The wingspan is 13–17 mm. Eupithecia nanata is a variable species.The forewings are pointed.The ground colour of the forewings ranges from gray to brown to yellowish-brown. In the midfield a contrasting dark lateral band sets itself apart: it initially runs at right angles from the costa. The black discal spot is sometimes unclear. There is a marginal white wavy line, which continues on the hind wings. These are partially paler than the forewings and have a small black discal spot.The fringes are brindled grey or brown and white.

The moths fly from March to September depending on the location.

The larvae feed on Calluna species and sometimes Achillea millefolium.

Subspecies[edit]

Etymology[edit]

The scientific name of the species is from the Latin language. nanus is a dwarf [2]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!