Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupithecia nanata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACCTCATTAAGATTACTAATTCGAGCTGAATTAGGTACCCCTGGATCTTTAATTGGAGATGACCAAATTTACAATACTATTGTTACAGCTCACGCATTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAACTGATTAGTGCCTTTAATATTAGGAGCCCCAGATATAGCCTTCCCTCGAATAAATAATATAAGTTTTTGATTATTACCCCCCTCTATTACATTATTAATTTCAAGAAGAATTGTGGAAAATGGAGCCGGAACTGGTTGAACAGTTTACCCCCCTTTATCCTCTAATATTGCTCATGGAGGAAGATCTGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCTTTATTTGTGTGAGCTGTAGGAATTACAGCTTTTTTACTTCTTTTATCTTTACCGGTATTGGCAGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eupithecia nanata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eupithecia nanata

The Narrow-winged Pug (Eupithecia nanata) is a moth of the family Geometridae. The species can be found all over Europe, except the South-East.

The wingspan is 13–17 mm. The moths flies from March to September depending on the location.

The larvae feed on Calluna species and sometimes Achillea millefolium.

Subspecies[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!