Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnoscelis rufifasciata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAATTGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAACACTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTACCCCCCTCTATCACTCTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACTGGATGAACAGTTTACCCCCCTCTATCTTCAAACATTGCTCATGGTGGAAGTTCTGTAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACTATTTTTAATATACGATTAAATAATATATTTTTTGATCAATTACCTCTATTTATTTGAGCTGTAGGAATTACAGCTTTCCTTTTATTACTCTCACTTCCAGTTTTAGCAGGAGCAATTACTATACTTTTAACAGATCGTAATCTTAATACATCATTTTTTGACCCTGCTGGTGGGGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gymnoscelis rufifasciata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 66
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Double-striped Pug

The Double-striped Pug (Gymnoscelis rufifasciata) is a moth of the family Geometridae. It is a widespread and common species, being found throughout the Palearctic region, the Near East and North Africa.

This is a variable species but always easy to recognize due to the two prominent dark fascia across each forewing which give the species its common name. The hindwings are pale grey with darker fringes and a small black discal spot. The wingspan is 15–19 mm. Two, sometimes three, broods are produced each year and the adults are on the wing in April and May (sometimes earlier), July and August, and sometimes later in the autumn. It flies at night and is attracted to light and flowers, both of its food plants and others.

The larva feeds on the flowers of a huge range of plants (see list below) and has also been known to feed on the larvae of other Lepidoptera. The species overwinters as a pupa.

Recorded food plants[edit]

References[edit]

  1. ^ "Home of Ichneumonoidea". Taxapad. Dicky Sick Ki Yu. 1997-2012. Retrieved 2013. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!