Physical Description
Type Information
Lectotype for Cyprinella venusta
Catalog Number: USNM 136
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen; Photograph
Collector(s): C. Kennerly
Year Collected: 1853
Locality: Rio Seco, Texas, Texas, United States, North America
Catalog Number: USNM 136
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen; Photograph
Collector(s): C. Kennerly
Year Collected: 1853
Locality: Rio Seco, Texas, Texas, United States, North America
- Lectotype: Gibbs, R. H. 1957. Tulane Studies in Zoology. 5 (8): 180.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paralectotype for Cyprinella venusta
Catalog Number: USNM 163955
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Kennerly
Locality: Rio Seco, Texas., Texas, United States, North America
Catalog Number: USNM 163955
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Kennerly
Locality: Rio Seco, Texas., Texas, United States, North America
- Paralectotype: Gibbs, R. H. 1957. Tulane Studies in Zoology. 5 (8): 180.
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Paralectotype for Cyprinella venusta
Catalog Number: USNM 140
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): C. Kennerly
Year Collected: 1854
Locality: Rio Sabinal, Texas., Uvalde County, Texas, United States, North America
Catalog Number: USNM 140
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): C. Kennerly
Year Collected: 1854
Locality: Rio Sabinal, Texas., Uvalde County, Texas, United States, North America
- Paralectotype:
© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Cyprinella venusta
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 12 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 12 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTACTTAGTATTTGGTGCCTGAGCTGGGATGGTGGGAACCGCTTTAAGCCTCCTCATTCGAGCTGAATTAAGTCAACCTGGCTCACTTCTAGGCGATGATCAGATCTACAATGTAATTGTTACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTCTTATCGGGGGGTTCGGGAACTGACTTGTGCCTCTAATGATTGGGGCACCTGACATAGCATTTCCACGAATGAATAACATAAGCTTCTGACTTCTACCCCCATCATTTCTCTTACTACTAGCTTCCTCTGGTGTTGAAGCCGGGGCCGGGACTGGATGAACTGTGTATCCCCCACTTGCGGGTAATCTTGCACATGCAGGAGCATCAGTAGACCTCACAATCTTCTCTCTGCACCTGGCGGGTGTATCCTCAATTTTGGGAGCAGTTAATTTCATTACTACGATTATTAACATGAAACCCCCAGCAATTTCCCAATATCAGACACCTCTGTTCGTATGAGCCGTACTTGTAACTGCCGTACTTCTACTCCTCTCACTGCCCGTCCTAGCTGCCGGGATTACTATACTTCTTACAGATCGTAATCTTAACACCACATTCTTTGACCCAGCAGGAGGGGGTGACCCTATTCTGTACCAACACTTA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Cyprinella venusta
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 14
Species With Barcodes: 1
Public Records: 12
Specimens with Barcodes: 14
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
