Physical Description

Type Information

Lectotype for Cyprinella venusta
Catalog Number: USNM 136
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen; Photograph
Collector(s): C. Kennerly
Year Collected: 1853
Locality: Rio Seco, Texas, Texas, United States, North America
  • Lectotype: Gibbs, R. H. 1957. Tulane Studies in Zoology. 5 (8): 180.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype for Cyprinella venusta
Catalog Number: USNM 163955
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Kennerly
Locality: Rio Seco, Texas., Texas, United States, North America
  • Paralectotype: Gibbs, R. H. 1957. Tulane Studies in Zoology. 5 (8): 180.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype for Cyprinella venusta
Catalog Number: USNM 140
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): C. Kennerly
Year Collected: 1854
Locality: Rio Sabinal, Texas., Uvalde County, Texas, United States, North America
  • Paralectotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyprinella venusta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTATTTGGTGCCTGAGCTGGGATGGTGGGAACCGCTTTAAGCCTCCTCATTCGAGCTGAATTAAGTCAACCTGGCTCACTTCTAGGCGATGATCAGATCTACAATGTAATTGTTACTGCTCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTCTTATCGGGGGGTTCGGGAACTGACTTGTGCCTCTAATGATTGGGGCACCTGACATAGCATTTCCACGAATGAATAACATAAGCTTCTGACTTCTACCCCCATCATTTCTCTTACTACTAGCTTCCTCTGGTGTTGAAGCCGGGGCCGGGACTGGATGAACTGTGTATCCCCCACTTGCGGGTAATCTTGCACATGCAGGAGCATCAGTAGACCTCACAATCTTCTCTCTGCACCTGGCGGGTGTATCCTCAATTTTGGGAGCAGTTAATTTCATTACTACGATTATTAACATGAAACCCCCAGCAATTTCCCAATATCAGACACCTCTGTTCGTATGAGCCGTACTTGTAACTGCCGTACTTCTACTCCTCTCACTGCCCGTCCTAGCTGCCGGGATTACTATACTTCTTACAGATCGTAATCTTAACACCACATTCTTTGACCCAGCAGGAGGGGGTGACCCTATTCTGTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cyprinella venusta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!