Evolution and Systematics

Evolution

Classification

Eupithecia dodeneata is a species of insect moth.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Theodore Ganea

Supplier: Theodore Ganea

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupithecia dodoneata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGTAACTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTACCCCCTTCTATTACACTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTATATCCCCCCTTATCCTCTAATATTGCTCATGGAGGAAGTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCGGGAATTTCTTCTATTTTAGGAGCAATTAACTTTATTACAACCATTATTAATATACGTTTAAATAACATATTTTTTGATCAACTACCTTTATTTGTTTGAGCGGTAGGAATTACAGCTTTTTTACTTCTTTTATCTTTACCTGTTTTAGCTGGTGCTATTACAATACTTTTAACAGATCGAAATTTAAATACCTCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eupithecia dodoneata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eupithecia dodoneata

The Oak-tree Pug (Eupithecia dodoneata) is a moth of the family Geometridae. The species can be found in Europe.

The wingspan is 19–22 mm. The ground colour of the forewings is usually light grey, sometimes slightly brownish on dusted. There are several dark grey crosslines are wavy and often in pairs. The outer cross line near the front edge with a sharp, inward-pointing V. The midfield is brighter in some specimens and framed by a thin dark band. The black median stain has an oval shape. The hind wings are slightly lighter than the forewings and have also several dark designs and a small black middle spot.

The moths flies from May to June depending on the location.

The larvae feed on Crataegus and Quercus species.

Subspecies[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!