Overview

Comprehensive Description

General Description

Newer methods of identification are being examined by Henry et al. (2002) to split the formerly described C. carnea into a series of morphologically similar sister species, based mainly on their vibrational courtship songs. Unfortunately, this is not practical for museum specimens or pictures, so morphological characters are based on Stephens' (1835) original description, still accurate for the current concept of C. carnea (Henry et al. 2002). However, it is important to note that work on the phylogeny of this group is still being done, and this description might change as the species limits are better defined. All species overwinter as adults, and C. carnea change to a dark brownish red colour during winter diapause. The head, thorax and abdomen are all rosy-red or flesh-coloured. The legs and antennae are pale yellow. The wings are short, ovate and iridescent, and the venation and stigma are reddish (Stephens, 1835).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Until recently C. carnea was considered a single Holarctic species distributed across North America, Europe, North Africa and Asia (Chapman et al. 2006). Now this species has been split into a complex of cryptic sibling species, and range limits for the individual species are not yet clear (Henry et al. 2002).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Holotype for Chrysopa vulgaris cephalica Navas, 1927
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male; Adult
Preparation: Pinned
Collector(s): A. Alfieri
Year Collected: 1924
Locality: EGYPTE// Ghizeh, obtenu d'elevage, Unknown, Egypt
  • Holotype: 1927. Bulletin de la Société Royale Entomologique d'Egypte. 10: 199.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Herbaceous vegetation in open fields during summer; urban areas in fall and spring.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Larvae are predaceous, and are used as biological control agents for pest aphid species all through the northern hemisphere (Chapman et al. 2006). Before moving back to fields in the spring after winter diapause, adults first feed on pollen from early flowering trees like Acer spp (Henry et al. 2002).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Chrysopa carnea preys on:
Acyrthosiphon spartii
Aphis sarathamni

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults fly to and from overwintering locations in the fall and spring.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The carnea species complex is made up of morphologically similar species that are reproductively isolated by their vibrational songs used in mate selection. They make these songs by vibrating their abdomens, which shakes the substrate they are standing on, and can attract mates within a close range. Males and females of the same species make similar songs, so they can match up their songs before mating. Males and females that make different songs will not match up, which isolates the different species (Henry et al. 2002). Eggs are generally oval in shape, and females lay them solitarily on individual stalks (Canard et al. 1984).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chrysoperla carnea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Chrysoperla carnea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCTGAATATTACCCCCTTCATTAACTTTATTACTTGCTTCTTCTATAGTAGAAAGAGGAGCTGGAACTGGTTGAACAGTTTACCCTCCTTTATCATCAAGAATTGCTCATGCTGGAGCTTCTGTTGATTTA---GCTATTTTTAGTTTACACCTTGCCGGTATTTCATCAATTTTAGGGGCAGTAAATTTCATTACAACAGTAATTAATATACGATTAAGTTATATAACATTAGATCGTATACCATTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTATTACTTTCATTACCTGTATTAGCTGGT---GCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCATTTTTTGACCCTGCGGGAGGAGGAGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTATATATTTTAATTTTACCAGGATTTGGAATAATTAGTCATATTATTGCTCAAGAAAGTGGAAAAAAG---GAAACCTTTGGATCTTTAGGAATAATTTATGCTATACTAGCTATTGGATTATTAGGATTTATTGTTTGAGCTCATCATATATTTACTGTTGGAATAGATGTTGATACTCGAGCTTACTTTACATCAGCTACAATAATTATTGCAGTTCCTACTGGTATTAAGGTCTTTAGTTGATTA---GCTACTTTACATGGAACT---CAATTTACATATAGTCCAGCTTTATTATGAAGTTTAGGATTTGTATTTTTATTTACTGTTGGAGGATTAACTGGAGTTGTATTAGCTAATTCATCAATTGATATTATTCTTCATGATACTTATTATGTAGTAGCTCATTTCCATTATGTT---TTATCGATAGGGGCAGTATTTGCTATTATAGCAGGATTTGTTCATTGATTCCCTTTATTTACAGGATTAACAATAAATCCTTTCTGATTAAAAATTCAATTTACAACAATATTTATTGGAGTAAATTTAACATTTTTCCCTCAACATTTTTTAGGTTTAGCTGGAATACCCCGT---CGTTATTCTGATTATCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chrysoperla carnea

Chrysoperla carnea, known as the common green lacewing, is an insect in the Chrysopidae family. It is found in many parts of America, Europe and Asia. Although the adults feed on nectar, pollen and aphid honeydew, the larvae are active predators and feed on aphids and other small insects. It has been used in the biological control of insect pests on crops.

Chrysoperla carnea was originally considered to be a single species with a holarctic distribution but it has now been shown to be a complex of many cryptic, sibling subspecies. These are indistinguishable from each other morphologically but can be recognised by variations in the vibrational songs the insects use to communicate with each other, which they especially do during courtship.[1]

Description[edit]

The green lacewing eggs are oval and secured to the plant by long slender stalks. They are pale green when first laid but become gray later. The larvae are about one millimetre long when they first hatch. They are brown and resemble small alligators, crawling actively around in search of prey.[2] They have a pair of pincer-like mandibles on their head with which they grasp their prey, sometimes lifting the victim off the leaf surface to prevent its escape. The larvae inject enzymes into the bodies of their victims which digest the internal organs, after which they suck out the liquidated body fluids.[3] The larvae grow to about eight millimetres long before they spin circular cocoons and pupate.[2]

Adult green lacewings are a pale green colour with long, threadlike antennae and glossy, golden, compound eyes. They have a delicate appearance and are from twelve to twenty millimetres long with large, membranous, pale green wings which they fold tent-wise above their abdomens. They are weak fliers and have a fluttery form of flight. They are often seen during the evenings and at night when they are attracted by lights.[2]

Life cycle[edit]

Chrysoperla carnea larva

The green lacewing adults overwinter buried in leaf litter at the edge of fields or other rough places, emerging when the weather warms up in spring. Each female lacewing lays several hundred small eggs at the rate of two to five per day, choosing concealed spots underneath leaves or on shoots near potential prey.[2] The eggs are normally laid during the hours of darkness.[4]

The larvae hatch in three to six days, eat voraciously and moult three times as they grow.[2] They feed not only on aphids but also on many other types of insects and even prey on larger creatures, such as caterpillars. They can consume large numbers of prey and completely destroy aphid colonies. When food is scarce they turn cannibal and eat each other.[3] After two to three weeks, the mature larvae secrete silk and build round, parchment-like cocoons in concealed positions on plants. From these, the adults emerge ten to fourteen days later. The length of the life cycle (under 4 weeks in summer conditions) is greatly influenced by the temperature and there may be several generations each year under favourable conditions.[2]

Biological control[edit]

Chrysoperla carnea adults eat pollen and honeydew and are not predatory, but the larvae have been recorded as feeding on seventy different prey species in five insect orders. The prey are mostly from the order Homoptera and are predominantly aphids on low growing vegetation.[4] On crops, the larvae have been reported as attacking several species of aphids, red spider mites, thrips, whitefly, the eggs of leafhoppers, leaf miners, psyllids, small moths and caterpillars, beetle larvae and the tobacco budworm. They are considered to be important predators of the long-tailed mealybug under glass.[5] C. carnea occurs naturally in many growing regions of the northern hemisphere. It is considered an important aphid predator in cotton crops in Russia and Egypt, sugar beet in Germany and vineyards in Europe.[2] It has been found to be effective at controlling the cotton whitefly, Bemisia tabaci, in cotton crops in Pakistan.[6] The presence of the larvae on the foliage was found to inhibit visitation and oviposition by B. tabaci which suggests the larvae may produce a volatile semiochemical which repels the whitefly.[4]

Although the larvae are effective as biological control agents, in open air environments the adult lacewings tend to disperse widely. They may remain in the original release location if they have sources of nectar, pollen or honeydew to feed on in the general vicinity. Commercial supplies of C. carnea, usually eggs, are available from many outlets in North America.[7]

When attempts were made to introduce the species into New Zealand and India, the lacewings failed to become established, perhaps because of the absence of certain yeast symbionts necessary to their development which were absent from their new environments.[4]

References[edit]

  1. ^ Henry, C. S.; Brooks, S. J.; Duelli, P.; Johnson, J. B. (2002). "Discovering the True Chrysoperla carnea (Insecta: Neuroptera: Chrysopidae) Using Song Analysis, Morphology, and Ecology". Annals of the Entomological Society of America 95 (2): 172. doi:10.1603/0013-8746(2002)095[0172:DTTCCI]2.0.CO;2. ISSN 0013-8746.  edit
  2. ^ a b c d e f g "Chrysoperla carnea". Cornell University. Retrieved 2011-01-21. 
  3. ^ a b "Aphid Control by Chrysoline carnea". Syngenta-bioline.co.uk. Retrieved 2011-01-21. 
  4. ^ a b c d T. S. Bellows; T. W. Fisher (1999). Handbook of biological control: principles and applications of biological control. Academic Press. pp. 418–. ISBN 978-0-12-257305-7. Retrieved 21 January 2011. 
  5. ^ Hoffmann, M.P. and Frodsham, A.C. (1993) Natural Enemies of Vegetable Insect Pests. Cooperative Extension, Cornell University, Ithaca, NY. 63 pp.
  6. ^ Kareim, A.I., 1998. Searching rate and potential of some natural enemies as bio-control agent against the Bemisia tabaci (Homoptera:Aleyrodidae). J. Appl. Entomol., 122: 487–92
  7. ^ "Suppliers of Beneficial Organisms in North America" (PDF). Retrieved 2011-01-21. 

Gallery[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!