Overview

Comprehensive Description

Longueur 125-145 cm, envergure 140-165 cm, poids 2,1-4,1 kg.

L’habitat est représenté par les lagunes et lacs côtiers fortement salés ou basiques (jusqu’à pH 11). La profondeur doit être faible (< 1 m) sur de grandes superficies, l’espèce se nourrissant dans la vase. Le succès de la reproduction n’est possible que dans des conditions optimales de niveaux hydriques et trophiques.

Le Flamant rose se nourrit de petits invertébrés, ainsi que de diatomées, protozoaires, algues, graines et autres éléments végétaux. Il s’alimente en groupe, de jour comme de nuit. La méthode la plus couramment adoptée consiste à avancer lentement, la tête retournée et immergée entre les pattes. L’eau est expulsée par un pompage de la langue, les matériaux étant retenus dans les lamelles du bec.

L’espèce est très grégaire, se regroupant par milliers sur les zones riches en nourriture. L’emplacement de la colonie varie peu et la ponte est synchronisée par groupes. Les parades et accouplements peuvent avoir lieu en dehors des sites de nid, de même que des ébauches de nid sont parfois construites à distance des colonies. La formation du couple est discrète et se fait probablement lors des recherches alimentaires. L’activité de parade, quant à elle, est sociale (groupes de quelques dizaines d’oiseaux) et les rituels ne sont pas alors directement destinés à un partenaire potentiel. Les deux parents couvent et prennent soin du poussin jusqu’à ce qu’il rejoigne une crèche à l’âge de 8-10 jours. Il peut être encore nourri pendant plusieurs jours mais n’est plus surveillé.

Le nid, en forme de cratère d’une trentaine de centimètres de diamètre, est fait de vase séchée au soleil. Une tranchée est visible sur son pourtour, d’où la vase servant à sa confection est extraite. La distance entre les nids est le plus souvent de 20 à 50 cm. La ponte unique (1 ou 2 œufs) est déposée à partir de la mi-avril, mais la date varie selon les températures et les niveaux d’eau. L’incubation dure 1 mois et l’envol a lieu entre 70 et 75 jours. La vie en crèche peut toutefois durer jusqu’au 100e jour.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is regularly seen from West Africa eastward throughout the Mediterranean to South West and South Asia, and throughout sub-Saharan Africa. The Palearctic population (including West Africa, Iran and Kazakhstan) is estimated to number between 205,000 and 320,000, the South West and South Asian populations combined at 240,000, and the sub-Saharan African populations between 100,000 and 120,000 (Delany and Scott 2006). The Palearctic population appears to be increasing, while the Asian and sub-Saharan African populations appear to be stable (Delany and Scott 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

S Europe and Medit. basin to S Africa and Indian subcontinent.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour Juveniles, and to a lesser extent adults (Mateo et al. 1998), are prone to irregular nomadic or partially migratory movements throughout the species's range in response to water-level changes (Snow and Perrins 1998, Hockey et al. 2005) or food availability (Brown et al. 1982). Members of the Palearctic population are partially migratory (del Hoyo et al. 1992, Snow and Perrins 1998) and regularly travel to warmer regions in the winter via favoured stop-over sites (del Hoyo et al. 1992) (non-breeders may be present all year round in the wintering areas) (Snow and Perrins 1998, Amat et al. 2005). In the Mediterranean and West Africa, breeding colonies appear to be linked by a significant frequency of juvenile and adult dispersal and are thus considered to belong to a single metapopulation (Balkiz 2006). Members of the Asian populations move from their breeding sites at inland lakes to coastal wetlands during non-breeding periods (Balachandran 2007), and when not breeding the sub-Saharan African population tends to disperse among the alkaline-saline lakes and wetlands of eastern and southern Africa (McCulloch et al. 2003, Baker et al. 2006). The Palearctic population breeds regularly from March to June in large dense single-species colonies of up to 20,000 pairs (occasionally up to 200,000 pairs) (del Hoyo et al. 1992) and in some regions may undergo a post-breeding flightless moult period where adults gather in flocks on inaccessible waters (Flint et al. 1984). The Asian and sub-Saharan populations breed irregularly following the rains, often in large mixed colonies with Lesser Flamingo Phoeniconaias minor (Brown and Root 1971, McCulloch and Irvine 2004, Balachandran 2007). The species is gregarious and commonly occurs in flocks of 100 or more outside of the breeding season (Brown et al. 1982), with thousands often flocking together (Brown et al. 1982) in areas rich in food or at freshwater inlets of saline or alkaline lakes to drink and bathe (Snow and Perrins 1998). In sub-Saharan Africa, the species may also join large flocks of non-breeding Lesser Flamingo. The species is a bottom feeder (Snow and Perrins 1998) and forages both by day and night (Brown et al. 1982), feeding by filtering particles through tiny platelets in the bill (Snow and Perrins 1998). It also often roosts at night in large flocks (Brown et al. 1982). Habitat The species inhabits shallow (c.1 m deep over a large area) (Snow and Perrins 1998) eutrophic waterbodies (Hockey et al. 2005) such as saline lagoons, saltpans and large saline or alkaline lakes (Brown et al. 1982, del Hoyo et al. 1992) up to pH 11 (Snow and Perrins 1998). It will also frequent sewage treatment pans, inland dams (Hockey et al. 2005), estuaries (Brown et al. 1982) and coastal waters (Diawara et al. 2007), seldom alighting on freshwater but commonly bathing and drinking from freshwater inlets entering alkaline or saline lakes (Brown et al. 1982). It nests and roosts on sandbanks (Brown et al. 1982, del Hoyo et al. 1992), mudflats (del Hoyo et al. 1992), islands (Brown et al. 1982) or boggy, open shores (Flint et al. 1984). Diet Its diet consists of crustaceans (del Hoyo et al. 1992) (especially brine shrimp Artemia salina) (Brown et al. 1982), molluscs, annelid worms, larval aquatic insects, small fish, adult terrestrial insects (e.g. water beetles, ants), the seeds or stolons of marsh grasses, algae, diatoms and decaying leaves (del Hoyo et al. 1992). It may also ingest mud in order to extract organic matter (e.g. bacteria) (del Hoyo et al. 1992). Breeding site The species nests in large dense colonies on mudflats or islands of large waterbodies, occasionally also on bare rocky islands (del Hoyo et al. 1992), with a distance between neighbouring nests of between 20 and 50 cm (Snow and Perrins 1998). The nest is usually an inverted cone of hardened mud (Flint et al. 1984) with a shallow depression on the top (alternatively it may be a small pile of stones and debris when mud is not available) (del Hoyo et al. 1992). Management information The removal of sand polluted with lead shot from a salt-lake in Cyprus was successful in significantly reducing the numbers of deaths due to lead poisoning (Miltiadou 2005). At two colonies (one in France and one in Spain) management techniques to counteract erosion and the lack of suitable nesting islands were successfully applied in order to encourage breeding by the species (Martos and Johnson 1996).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Phoenicopterus roseus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phoenicopterus roseus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGACTTTCATTAACCGATGATTATTCTCAACCAACCACAAAGATATCGGCACCCTATACCTGATTTTCGGTGCATGAGCCGGGATAGTTGGCACAGCCCTAAGCCTACTCATTCGCGCAGAACTGGGACAACCTGGAACTCTCCTAGGAGACGACCAAATCTATAACGTAATCGTTACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATTGGAGGTTTCGGAAACTGACTGGTTCCACTCATAATTGGTGCTCCTGACATAGCATTTCCCCGCATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTCTTACTCCTCCTGGCCTCCTCCACAGTAGAAGCTGGAGCAGGCACAGGATGAACTGTGTACCCACCACTAGCTGGCAACATAGCCCATGCCGGAGCCTCAGTAGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTGTATCATCTATTCTCGGAGCAATCAACTTTATCACTACTGCTATCAACATAAAACCACCTGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCTGTCCTCATCACCGCTGTCCTATTACTACTCTCACTTCCAGTCCTTGCCGCCGGCATTACCATACTACTAACAGACCGAAACCTAAACACCACATTCTTCGATCCAGCCGGAGGAGGCGACCCGGTCCTATACCAGCACCTCTTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTACCAGGCTTTGGAATTATCTCACATGTAGTAACATACTATGCAGGCAAAAAAGAACCATTCGGTTACATGGGAATAGTATGAGCCATATTATCCATCGGATTCCTAGGCTTCATCGTATGAGCCCACCACATGTTCACTGTAGGAATGGACGTAGATACCCGAGCATACTTCACATCCGCCACCATAATCATCGCCATCCCAACAGGTATTAAAGTCTTTAGCTGACTAGCCACCCTACACGGAGGGACTATCAAATGAGACCCCCCAATACTTTGAGCCCTGGGCTTTATTTTCCTCTTTACTATTGGAGGCCTCACAGGAATCGTACTAGCAAACTCCTCACTAGACATCGCCTTACACGACACATACTATGTAGTTGCCCACTTCCACTATGTTCTCTCAATAGGAGCAGTCTTTGCCATCCTAGCAGGATTTACCCACTGATTCCCACTATTCACAGGGTACACCCTACACCCCACATGAGCCAAGGCTCATTTTGGGGTCATATTCACAGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTGGGCCTAGCCGGCATGCCACGACGATACTCGGACTACCCAGATGCCTACACCCTGTGAAACACCGTATCCTCCATCGGGTCATTAATCTCAATAACCGCCGTAATCATACTAATATTCATCATTTGAGAAGCCTTCGCATCAAAACGGAAAGTCCTACAACCAGAACTACCTGCCACCAACGTCGAATGAATCCACGGCTGCCCACCTCCATATCACACCTTCGAAGAACCAGCCTTTGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Childress, B.

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species suffers from low reproductive success if exposed to disturbance at breeding colonies (Ogilvie and Ogilvie 1986, Yosef 2000) (e.g. from tourists, low-flying aircraft (Ogilvie and Ogilvie 1986) and especially all-terrain vehicles (Yosef 2000)), or if water-levels surrounding nest-sites lower (resulting in increased access to and therefore predation from ground predators such as foxes and feral dogs) (Miltiadou 2005). The lowering of water levels in lakes can also lead to hyper-salinity which may affect food resources (Nasirwa 2000). Other threats to the species's habitat include effluents from soda-ash mining (Nasirwa 2000, Hockey et al. 2005), pollution from sewage and heavy metal effluents from industries (Nasirwa 2000). The species also suffers mortality from lead poisoning (lead shot ingestion) (Mateo et al. 1998, Miltiadou 2005), collisions with fences and powerlines (Hockey et al. 2005), and from diseases such as tuberculosis, septicemia (Nasirwa 2000) and avian botulism (van Heerden 1974). Utilisation In Egypt large numbers of adults are shot or captured to be sold in markets (del Hoyo et al. 1992), and egg collecting from colonies occurs in some areas (this may become a threat) (Ogilvie and Ogilvie 1986).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greater flamingo

Voice of the greater flamingo

The greater flamingo (Phoenicopterus roseus) is the most widespread species of the flamingo family. It is found in parts of Africa, southern Asia (coastal regions of Pakistan and India), and southern Europe (including Spain, Albania, Turkey, Greece, Cyprus, Portugal, Italy and the Camargue region of France). Some populations[which?] are short distance migrants, and sightings north of the breeding range are relatively frequent; however, given the species' popularity in captivity, whether or not these are truly wild individuals is a matter of some debate. A single bird was seen on North Keeling Island (Cocos (Keeling) Islands) in 1988.

Description[edit]

This is the largest species of flamingo, averaging 110–150 cm (43–60 in) tall and weighing 2–4 kg (4.4–8.8 lbs). The largest male flamingos have been recorded at up to 187 cm (74 in) tall and 4.5 kg (10 lbs).[4] It is closely related to the American flamingo and Chilean flamingo, with which it has sometimes been considered conspecific, but that treatment is now widely seen (e.g., by the American and British Ornithologists' Union) as incorrect and based on insufficient evidence.[citation needed]

Greater flamingo egg - taken at Cincinnati Zoo

Like all flamingos, this species lays a single chalky-white egg on a mud mound. Most of the plumage is pinkish-white, but the wing coverts are red and the primary and secondary flight feathers are black. The bill is pink with a restricted black tip, and the legs are entirely pink. The call is a goose-like honking. Sub-adult flamingos are whitish-grey and only attain the pink coloration several years into their adult life. The coloration comes from the carotenoid pigments in the organisms that live in their feeding grounds.

The bird resides in mudflats and shallow coastal lagoons with salt water. Using its feet, the bird stirs up the mud, then sucks water through its bill and filters out small shrimp, seeds, blue-green algae, microscopic organisms and mollusks. The greater flamingo feeds with its head down and its upper jaw is movable and not rigidly fixed to its skull.[5]

Lifespan[edit]

The average lifespan in captivity, according to Zoo Basel, is over 60 years.

The oldest known greater flamingo was a bird at the Adelaide Zoo in Australia who died aged at least 83 years old. The bird's exact age is not known; he was already a mature adult when he arrived in Adelaide in 1933. He was euthanized in January 2014 due to complications of old age.[6] Known as "Greater" or "Flamingo 1",[7] Adelaide Zoo's greater flamingo survived an attack by four youths in 2008.[8]

Relationship with humans[edit]

Captivity[edit]

Flamingo colony at Zoo Basel
Size comparison with great white pelican

The first recorded zoo hatch was in 1959 at Zoo Basel. In Zoo Basel's breeding program over 400 birds have been hatched with an average of between 20 and 27 per year since 2000. [9]

Because of Zoo Basel's extraordinarily successful breeding program and a lack of room, most of the hatchlings are sent to zoos around the world. Given the history and the large number of birds hatched in Basel since 1959, it may be concluded that most of the greater flamingo zoo colonies around the world are related to the one at Basel.

In January, 2014, an 83-year-old greater flamingo, believed to be the oldest in the world, died at the Adelaide Zoo in Australia where it had lived since 1933.[10]

Threats[edit]

In the Rann of Kutch salt marsh of India and Pakistan, greater flamingos are occasionally electrocuted when they sit on 1000-watt electric cables near their breeding areas. Recently 139 deaths were officially recorded in the region.[citation needed]

History[edit]

Roman emperors considered flamingo tongues a delicacy.[5]

References[edit]

  1. ^ BirdLife International (2012). "Phoenicopterus roseus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Leguat 1891, p. 210 Vol. 2
  3. ^ Rothschild 1907, p. 151 and Plate 31
  4. ^ http://en.tourduvalat.org/content/download/7378/73859/version/2/file/All+About+Greater+Flamingo.pdf
  5. ^ a b "Flamingo Feeding". Stanford University. Retrieved 11 March 2013. 
  6. ^ "Greater, the 83-year-old Adelaide Zoo flamingo, dies". The Australian. 31 January 2014. Retrieved 31 January 2014. 
  7. ^ "Video: The Flamingo Returns". The Australian. 31 January 2014. Retrieved 31 January 2014. 
  8. ^ "Bashed flamingo back on its feet at Adelaide Zoo". The Australian. Retrieved 31 January 2014. 
  9. ^ (German)"50 years of flamingo breeding". Basler Zeitung. 13 August 2008. Retrieved 21 March 2010. 
  10. ^ Fedorowytsch, Tom (31 January 2014). "Flamingo believed to be world's oldest dies at Adelaide Zoo aged 83". ABC Radio Australia. Retrieved 31 January 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!