Overview

Comprehensive Description

Common Names

The Odontodactylus scyllarus, commonly known as the Peacock Mantis Shrimp, is also known as the Painted Mantis and the Harlequin Mantis.(1)

(1)http://www.buzzle.com/articles/peacock-mantis-shrimp.html

11/19/10

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Supplier: Will Romano

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Neotype for Odontodactylus scyllarus (Linnaeus, 1758)
Catalog Number: USNM 274325
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): M. Erdmann
Year Collected: 1993
Locality: Greater Sunda Islands, Celebes Island, Rinca, Sulawesi, Indonesia, North Pacific Ocean
  • Neotype: Ahyong, S. T. 2001. Revision fo the Australian Stomatopod Crustacea. Records Of The Australian Museum Supplement. 26: 1-326.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 10 - 58
  Temperature range (°C): 24.377 - 28.284
  Nitrate (umol/L): 0.146 - 0.200
  Salinity (PPS): 34.531 - 35.563
  Oxygen (ml/l): 4.508 - 4.956
  Phosphate (umol/l): 0.087 - 0.176
  Silicate (umol/l): 1.454 - 3.012

Graphical representation

Depth range (m): 10 - 58

Temperature range (°C): 24.377 - 28.284

Nitrate (umol/L): 0.146 - 0.200

Salinity (PPS): 34.531 - 35.563

Oxygen (ml/l): 4.508 - 4.956

Phosphate (umol/l): 0.087 - 0.176

Silicate (umol/l): 1.454 - 3.012
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Odontodactylus scyllarus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TATTTCATTTTAGGGGCTTGATCAGGTATAGCGGGAACGGCCCTCAGATTAATCATCCGGGCCGAGCTTGGTCAACCGGGTAGATTAATTGGGGAT---GATCAAATTTATAATGTAGTTGTCACTGCCCACGCCTTTATTATGATTTTCTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAACTGACTTGTCCCACTCATGTTAGGGGCTCCTGATATAGCTTTCCCTCGGATGAATAATATGAGTTTCTGATTACTTCCCCCAGCACTCACTCTACTTTTATCAAGAGGTATAGTGGAAAGAGGAGTAGGTACAGGATGAACTGTCTACCCTCCCTTGGCAGCCGGGATTGCCCACGCAGGGGCTTCAGTGGACTTAGGTATCTTTTCTTTACATATAGCAGGAGCTTCATCAATTCTGGGAGCAGTAAACTTTATCACTACTGTTATTAACATACGCTCTAACGGTATGACTATAGACCGTATACCTTTATTTGTATGGGCTGTATTTATTACCGCAATCTTACTTCTACTATCTCTTCCCGTATTAGCTGGAGCTATTACTATACTTCTTACTGACCGTAATCTTAATACTTCTTTTTTTGATCCTGCCGGAGGGGGAGACCCTGTTTTATATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Odontodactylus scyllarus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Odontodactylus scyllarus

Odontodactylus scyllarus, known as the peacock mantis shrimp, harlequin mantis shrimp, painted mantis shrimp, or clown mantis shrimp, is a large mantis shrimp native to the Indo-Pacific from Guam to East Africa.[1]

In the saltwater aquarium trade, it is both prized for its attractiveness and considered by others to be a dangerous pest.

Description[edit]

O. scyllarus is one of the larger, more colourful mantis shrimps commonly seen, ranging in size from 3 to 18 centimetres (1.2 to 7.1 in).[1] They are primarily green in colour, with orange legs and leopard-like spots on the anterior carapace.[1]

Their ability to see circularly polarised light has led to studies to determine if the mechanisms by which their eyes operate can be replicated for use in reading CDs and similar optical information storage devices.[2][3]

Ecology[edit]

Odontodactylus scyllarus is a burrower, constructing U-shaped holes in the loose substrate near the bases of coral reefs in water ranging from 3 to 40 metres (9.8 to 131.2 ft) deep.[1]

O. scyllarus is a smasher, with club-shaped raptorial appendages.[1] An active hunter, it prefers gastropods, crustaceans, and bivalves,[1] and will repeatedly smash its prey until it can gain access to the soft tissue for consumption. It is reported to have a "punch" of over 50 miles per hour (80 km/h). This is the fastest recorded punch of any living animal. The acceleration is similar to that in a .22 caliber handgun, with 200 pounds-force (890 N) per strike. In addition, the surface of its appendages is made up of extremely dense hydroxyapatite, layered in a manner which is highly resistant to fracturing. Glass aquaria can be broken by them. The composition is being investigated for potential synthesis and engineering use.[4][5]

Aquaria[edit]

Some saltwater aquarists keep peacock mantis shrimp in captivity.[6] The peacock mantis is especially colorful and desired in the trade.

While some aquarists value peacock shrimp, others consider them harmful pests, because they:

  • Are voracious predators, eating other desirable inhabitants of the tank,
  • Can, in some of the largest specimens, break aquarium glass by striking it
  • Can do more damage burrowing in live rock than the fishkeeper would prefer

The live rock with mantis shrimp burrows are actually considered useful by some in the marine aquarium trade and are often collected. It is not uncommon for a piece of live rock to convey a live mantis shrimp into an aquarium. Once inside the tank, they may feed on fish, and other inhabitants. They are notoriously difficult to catch when established in a well-stocked tank,[7] and there are accounts of them breaking glass tanks, it should be noted that whilst stomatopods do not eat coral the smashers can damage it if they wish to make a home within it.[8]

References[edit]

  1. ^ a b c d e f Roy Caldwell. "Species: Odontodactylus scyllarus". Roy's List of Stomatopods for the Aquarium. Retrieved July 18, 2006. 
  2. ^ John Roach (June 27, 2011). "Shrimp eyes inspire optical tech". MSNBC. Retrieved June 28, 2011. 
  3. ^ Yi-Jun Jen, Akhlesh Lakhtakia, Ching-Wei Yu, Chia-Feng Lin, Meng-Jie Lin, Shih-Hao Wang & Jyun-Rong Lai (2011). "Biologically inspired achromatic waveplates for visible light". Nature Communications 2: 363. Bibcode:2011NatCo...2E.363J. doi:10.1038/ncomms1358. PMID 21694711. 
  4. ^ Sarah Everts (2012). "How a peacock shrimp packs a punch: layered structure is behind animal's resilient club". Chemical & Engineering News 90 (24): 6. 
  5. ^ James C. Weaver, Garrett W. Milliron, Ali Miserez, Kenneth Evans-Lutterodt, Steven Herrera, Isaias Gallana, William J. Mershon, Brook Swanson, Pablo Zavattieri, Elaine DiMasi & David Kisailus (2012). "The stomatopod dactyl club: a formidable damage-tolerant biological hammer". Science 336 (6086): 1275–1280. Bibcode:2012Sci...336.1275W. doi:10.1126/science.1218764. PMID 22679090. 
  6. ^ A Load of Learnin' About Mantis Shrimps, by James Fatherree, in ReefKeeping online magazine.
  7. ^ Nick Dakin (2004). The Marine Aquarium. London: Andromeda. ISBN 1-902389-67-0. 
  8. ^ April Holladay (September 1, 2006). "Shrimp spring into shattering action". USA Today. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!