Overview

Brief Summary

WhyReef - Lifestyle

Like snails and sea slugs, the tiger cowrie is a gastropod. Most gastropods have shells and muscular feet that they use to move around. Tiger cowries spend most of their time hiding under rocks or dead coral on the reef. At night, they come out to look for food. Even though they may look harmless, they’re predators that use their many rows of teeth to crunch and scrape up my food.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

WhyReef - Fun Facts

The tiger cowrie has a beautiful, glossy shell, which, in ancient times, was used as money! In order to keep its shell shiny and clean, the tiger cowrie wraps part of its body, called the mantle, around the outside of its shell. But the tiger cowrie’s shell also protects it: if a predator scares it, it can hide its entire body inside its shell.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

A solid, thick, heavy, inflated shell, up to 13 cm. Dorsally white or pale reddish-brown with large dark brown spots, and sometimes a reddish longitudinal stripe. Habitat: under coral and boulders in shallow or deep water. Distribution: Indo-Pacific. Regional names: Kis. Kururu, Makunguru; Port. Cipreia tigre. (Richmond, 1997).
  • Burgess, C.M. (1970). The Living Cowries. AS Barnes and Co, Ltd. Cranbury, New Jersey
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 1 - 28
  Temperature range (°C): 25.420 - 28.409
  Nitrate (umol/L): 0.146 - 0.617
  Salinity (PPS): 33.821 - 35.125
  Oxygen (ml/l): 4.336 - 4.700
  Phosphate (umol/l): 0.129 - 0.238
  Silicate (umol/l): 1.900 - 4.102

Graphical representation

Depth range (m): 1 - 28

Temperature range (°C): 25.420 - 28.409

Nitrate (umol/L): 0.146 - 0.617

Salinity (PPS): 33.821 - 35.125

Oxygen (ml/l): 4.336 - 4.700

Phosphate (umol/l): 0.129 - 0.238

Silicate (umol/l): 1.900 - 4.102
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

WhyReef - Menu

Tiger cowries eat turf algae and sponges, but will also eat fire coral and anemones, whose stinging cells don’t scare them! Since it eats plants and animals, it is an omnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cypraea tigris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cypraea tigris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTATATGATCAGGCTTAGTTGGGACAGCCCTTAGTTTATTAATTCGAGCAGAATTGGGGCAACCAGGAGCCTTATTAGGGGAT---GACCAGCTATACAATGTAATTGTAACGGCTCATGCATTTGTTATAATTTTCTTTTTAGTTATACCTATAATAATTGGTGGGTTCGGGAACTGACTTGTTCCGTTAATGTTAGGAGCCCCAGATATAGCTTTCCCACGTTTAAATAATATGAGTTTCTGGCTTCTTCCACCCGCTCTTCTTCTTTTGCTTTCCTCAGCGGCTGTTGAAAGAGGAGTTGGAACAGGTTGAACAGTGTATCCTCCCTTAGCAGGAAATCTTGCTCATGCTGGGGGATCAGTTGATCTTGCAATTTTTTCGTTGCACCTTGCTGGTGTATCATCTATTCTAGGTGCCGTGAATTTTATCACAACTATTATCAATATACGGTGACGAGGAATACAATTTGAACGGCTTCCATTATTTGTCTGATCAGTAAAAATTACTGCAGTTTTATTGCTGCTTTCTCTACCTGTCTTGGCTGGAGCGATTACAATATTATTGACAGATCGAAATTTTAACACAGCCTTCTTTGACCCTGCGGGAGGAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Museum Victoria
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

WhyReef - Threats

Many people think the tiger cowrie’s shell is very beautiful, and they like to use it as jewelry. But people must be careful not to take too many of them out of the reef!

Reefs are in danger, and that means so is the home of the tiger cowrie!

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cypraea tigris

Cypraea tigris, commonly known as the tiger cowrie, is a species of cowry, a large sea snail, a marine gastropod mollusk in the family Cypraeidae, the cowries.

Taxonomy[edit]

Drawing of the radula teeth of Cypraea tigris.

The tiger cowry was one of the many species originally described by Linnaeus in his 18th century work, Systema Naturae, and the species still bears its original name of Cypraea tigris.[1] Its specific epithet tigris relates to its common name "tiger" (the shell however is spotted, not striped). This species is the type species of the genus Cypraea.

Subspecies and forms[edit]

Description[edit]

As is the case in most cowries, the subadult shell of Cypraea tigris has a different color pattern. The apex of the shell is a barely visible tubercule at the top right of the shell image

Roughly egg-shaped and dextral, the glossy shell is large and heavy for a cowry. It measures up to 15 cm (6 in) in length, and the upper or dorsal side is white, pale bluish-white, or buff, densely covered with dark brown or blackish barely circular spots. Akin to many other Cypraea snails, the shells surface is notably effulgent, as if it were deliberately polished. There is sometimes a blurred red line along the length of the shell at the midline on the dorsal surface. The lower margins are rounded (that is, there is no sharp margin between the upper and lower surfaces of the shell as is found in some other cowries). The ventral side is white or whitish, and the shell opening is lined with tooth-like serrations.[10]

As is the case in almost all cypraeids, two lateral extensions of the mantle are able to extend so as to cover the shell completely, meeting at the midline of the dorsal surface. The mantle can also withdraw into the shell opening when threatened. In this species, the exterior surface of the mantle has numerous pin-like projections that are white-tipped.

Distribution and habitat[edit]

The tiger cowrie is found on the ocean floor in the Indo-Pacific region, from the eastern coast of Africa to the waters of Micronesia and Polynesia, the Coral Sea and around the Philippines. Along the Australian Coast it is found from Northern New South Wales to northern Western Australia, as well as Lord Howe Island, and along the east coast of Africa including Madagascar.[10] Found between depths of 10 and 40 metres (35–130 ft), it is often associated with live coral colonies, such as the table-forming Acropora,[11] either found on the reefs themselves or the sandy sea bottom nearby.[10] Once common, it is now much less abundant due to shell collecting and the destruction of its habitat by such processes as dynamite fishing, especially in shallower areas.[10] Carnivorous, the adult tiger cowrie eats coral and various invertebrates, while juveniles eat algae.

This species is endangered in Singapore.[11]

Human use[edit]

A decorative carving or cameo cut into the shell of a Cypraea tigris

Despite the fact that this species does not occur in the Mediterranean Sea, shells of the tiger cowrie and the related panther cowrie, Cypraea pantherina, have been unearthed at Pompeii, the ancient Roman city near Naples, Italy, where these shells may have been used as some form of ornament.[12] It is also conceivable that the shells were part of a natural history collection. There was an interest in natural history at the time, as exemplified by Pliny the Elder who wrote extensively about seashells in his book Natural History and who died investigating the eruption of Vesuvius.

The shells of this species of cowry are still popular among shell collectors, and are also used as a decorative object, even in modern times.

The shell of Cypraea tigris is believed to help to facilitate childbirth: some women in Japan hold a shell of this species during childbirth.

Large cowry shells such as that of this species were used in Europe in the recent past as a frame over which sock heels were stretched for darning, i.e. instead of using a darning egg. The cowry's smooth surface allows the darning needle to be positioned under the cloth more easily than when using a darning mushroom made of wood.

Gallery[edit]

See also[edit]

References[edit]

  1. ^ a b (Latin) Linnaeus, C. (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 211. 
  2. ^ Gastropods.com : Cypraea tigris; accessed : 21 October 2010
  3. ^ Gastropods.com : Cypraea tigris incana; accessed : 21 October 2010
  4. ^ Gastropods.com : Cypraea tigris lyncicrosa; accessed : 21 October 2010
  5. ^ Gastropods.com : Cypraea tigris pardalis; accessed : 21 October 2010
  6. ^ Gastropods.com : Cypraea tigris schilderiana ; accessed : 21 October 2010
  7. ^ Foin, T. C. (1972). "Ecological influence on the size of Cypraea tigris L., 1758, in the Pacific". Journal of Molluscan Studies 40 (3): 211. 
  8. ^ Kay E. A. 1961. On Cypraea tigris schilderiana Cate. The Veliger 4: 36–40
  9. ^ Gastropods.com : Cypraea tigris tuberculifera; accessed : 21 October 2010
  10. ^ a b c d Poutiers, J. M. (1998). "Gastropods". In Carpenter, K. E. FAO Species Identification Guide for Fishery Purposes: The living marine resources of the Western Central Pacific Volume 1. "Seaweeds, corals, bivalves and gastropods". Rome: United Nations FAO. pp. 494–495. ISBN 92-5-104051-6. 
  11. ^ a b (file created 1 April) 2009. Singapore Red Data Book 2008. Accessed 6 September 2009.
  12. ^ Jashemski, W. M. F.; Meyer, Frederick Gustav (2002). The Natural History of Pompeii. Cambridge: Cambridge University Press. pp. 306–07. ISBN 0-521-80054-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!