Molecular Biology and Genetics

Molecular Biology

Barcode data: Bactra lancealana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATTTTCGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCGTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTCTTCCACCATCTATTATACTGTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACCGGATGAACAGTATACCCCCCACTTTCATCAAATATTGCTCATAGAGGAAGATCTGTTGATCTTGCTATTTTCTCCTTACATTTAGCTGGAATTTCATCAATTTTAGGTGCTGTTAATTTTATTACAACTATTATTAATATACGGCCTAATAATATATCACTAGATCAAATACCCCTATTTGTATGATCTGTGGGAATTACAGCTTTACTACTTTTACTTTCTTTACCTGTATTAGCAGGAGCTATTACCATATTATTAACAGATCGAAATCTTAATACATCATTCTTTGATCCTGCAGGAGGAGGTGATCCTATCCTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bactra lancealana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 52
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bactra lancealana

Bactra lancealana is a moth of the family Tortricidae found in Europe. The moth has a wingspan of 11–20 mm. and flies from May to October.[1] Bactra lancealana larvae mainly feed on various rushes, including Juncus and Scirpus.

Notes[edit]

  1. ^ The flight season refers to Belgium and the Netherlands. This may vary in other parts of the range.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!