Molecular Biology and Genetics

Molecular Biology

Barcode data: Chloroclystis v-ata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTCTGATTATTACCTCCTTCTATTACTCTTTTAATTTCAAGTAGAATTGTTGAAAATGGAGCTGGAACAGGTTGAACAGTTTACCCCCCTTTATCTTCTAATATTGCCCATGGAGGAAGATCAGTTGATTTAGCTATTTTCTCCTTACACTTAGCAGGTATTTCCTCAATTTTAGGGGCAATTAATTTTATTACAACTATTATTAATATACGATTAAATAATATATTTTTTGATCAATTACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTCTTACTTTTACTGTCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATCTTAATACATCATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chloroclystis v-ata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

V-Pug

The V-Pug (Chloroclystis v-ata) is a moth of the family Geometridae. It is found throughout the Palearctic region, the Near East and North Africa. It is well distributed in the British Isles except for the north of Scotland.

Larva

The forewings of newly emerged adults are green with a characteristic v-shaped black mark which is part of a crossline. The green colouring fades over time but the markings, small size (14-19 mm.) and triangular resting posture make this an easy species to identify. The hindwings are greyish white. Either one or two broods are produced each year and adults can be seen at any time between May and August. The species flies at night and is attracted to light.

The green larva, usually with 3 reddish stripes, feeds on the flowers of a wide range of plants (see list below). The species overwinters as a pupa.

Subspecies[edit]

  • Chloroclystis v-ata v-ata
  • Chloroclystis v-ata lucinda (Butler, 1879)
  • Chloroclystis v-ata relicta Krogerus, 1996

Recorded food plants[edit]

References[edit]

  1. ^ "Home of Ichneumonoidea". Taxapad. Dicky Sick Ki Yu. 1997–2012. Retrieved 2013. 
  • Chinery, Michael Collins Guide to the Insects of Britain and Western Europe 1986 (Reprinted 1991)
  • Skinner, Bernard Colour Identification Guide to Moths of the British Isles 1984
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!