Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Phryxe nemea is endoparasitoid of larva of Epirrita dilutata

Animal / parasitoid / endoparasitoid
larva of Smidtia conspersa is endoparasitoid of larva of Epirrita dilutata

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Epirrita dilutata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Epirrita dilutata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTGGAATCTGAGCAGGTATAATTGGAACTTCTTTAAGACTACTAATTCGAGCAGAATTAGGAAACCCAGGATCCTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATCTTTTTTATAGTTATACCTATTATAATCGGAGGNTTTGGAAATTGATTAGTCCCTTTAATATTAGGGGCCCCTGATATAGCTTTCCCNCGAATAAATAATATAAGATTTTGATTACTGCCCCCATCAATTACCCTTTTAATTTCTAGAAGAATTGTAGAAAATGGGGCTGGAACTGGATGAACTGTCTATCCCCCTTTATCCTCTAATATTGCCCATGGGGGAAGCTCCGTAGATTTGGCTATTTTTTCCCTTCATTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATGCGATTAAATAATATATTTTTTGACCAATTACCTCTTTTTGTATGAGCTGTTGGAATCACAGCATTTTTACTTTTACTATCTTTACCAGTATTAGCTGGAGCTATCACAATATTATTAACAGACCGAAATTTAAACACATCATTTTTCGACCCTGCTGGAGGAGGAGATCCTATCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

November Moth

The November Moth (Epirrita dilutata) is a moth of the family Geometridae. It is found throughout Europe (including the British Isles) and the Near East.

The wingspan is 38–44 mm, the forewings being variably marked with alternating pale and dark bands. Melanism is common and in some locations all-dark individuals make up the majority of the population. The species is extremely similar to two of its relatives, Pale November Moth and Autumnal Moth, and they cannot usually be separated without examination of the genitalia. The November Moth flies at night from September to November[1] and is attracted to light and sometimes to nectar-rich flowers.

The caterpillar is green with red markings and feeds on a wide range of trees and shrubs (see list below). The species overwinters as an egg.

Recorded food plants[edit]

Notes[edit]

  1. ^ The flight season refers to the British Isles. This may vary in other parts of the range.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!