Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Siphona setosa is endoparasitoid of larva of Allophyes oxyacanthae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Allophyes oxyacanthae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTCTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTGCTAATTCGAGCAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTCCCACTAATACTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTCTCCCCCCGTCACTTACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATGGCGGAAGATCTGTTGATCTCGCAATTTTCTCTCTACATTTAGCTGGGATCTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACCATATTATTAACTGATCGTAATTTAAATACATCATTTTTTGATCCAGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Allophyes oxyacanthae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Allophyes oxyacanthae

The Green-brindled Crescent (Allophyes oxyacanthae) is a moth of the family Noctuidae. It is found in Europe.

Larva

The wingspan is 35–45 mm. The moth flies from September to November depending on the location.

The larvae feed on Crataegus, Prunus spinosa, Birch and various fruit bearing trees.[1]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!