Allophyes oxyacanthae — Details

Green-brindled Crescent learn more about names for this taxon

Ecology

Associations

Learn more about this article

Animal / parasitoid / endoparasitoid
larva of Siphona setosa is endoparasitoid of larva of Allophyes oxyacanthae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© BioImages

Source: BioImages - the Virtual Fieldguide (UK)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Allophyes oxyacanthae

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTCTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTGCTAATTCGAGCAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTCCCACTAATACTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTCTCCCCCCGTCACTTACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATGGCGGAAGATCTGTTGATCTCGCAATTTTCTCTCTACATTTAGCTGGGATCTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTTTTATTATTATTATCATTACCAGTTTTAGCAGGAGCTATTACCATATTATTAACTGATCGTAATTTAAATACATCATTTTTTGATCCAGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Allophyes oxyacanthae

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Allophyes oxyacanthae

Learn more about this article

The Green-brindled Crescent (Allophyes oxyacanthae) is a moth of the family Noctuidae. It is found in Europe.

Mounted

The wingspan is 35–45 mm. The moth flies from September to November depending on the location.

The larvae feed on Crataegus, Prunus spinosa, Birch and various fruit bearing trees.[1]

References

  1. ^ "Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernández, 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". http://www.nhm.ac.uk/research-curation/research/projects/hostplants/.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!