Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupithecia denotata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATCTTTGGAATTTGAGCAGGTATAATTGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATGGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTACTACCCCCTTCTATCACTCTACTAATTTCCAGAAGAATTGTAGAAAATGGGGCTGGAACTGGATGAACCGTCTATCCTCCCCTATCCTCTAATATCGCTCATGGAGGAAGTTCTGTTGACTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGCTTAAATAATATATTTTTTGATCAATTACCTTTATTTGTATGAGCAGTAGGAATTACAGCTTTCTTGCTTCTTTTATCTTTACCTGTATTAGCAGGTGCTATTACCATACTTTTAACTGATCGAAATTTAAATACATCATTCTTTGACCCAGCAGGTGGGGGAGATCCAATCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eupithecia denotata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eupithecia denotata

The Campanula Pug (Eupithecia denotata) is a moth of the Geometridae family. The species can be found from western Europe to central Asia and China.

The wingspan is about 20 mm. There is one generation per year with adults on wing from the beginning of May to August.

The larvae feed on Campanula species, including Campanula trachelium. Larvae of subspecies jasioneata feed on Jasione montana. Larvae can be found from August to October. It overwinters as a pupa.

Subspecies

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!