Overview

Brief Summary

Biology

The larvae occur amongst roots or aquatic plants. They are active mainly at night, and like other damselfly larvae are active predators. Larval development takes around two years, and they overwinter twice in the mud at the bottom of the river or pond (3). Larvae often travel for up to 100m out of water before the adult emergence occurs, typically in a shrub or tree (3). The flight period of adults is between May and the end of September (2). They take 7-10 days to mature following emergence, after which time they fly to breeding sites. Males hold territories around suitable egg-laying sites amongst vegetation that protrudes from the water, or they perch on vegetation at the riverside (4). Whilst the territory-holding males actively court females with a fluttering display flight (3), perching males try to mate with any female that passes by (4). Occasionally, males will fight over a territory, engaging in contest of a series of stereotypical flights for hours (3). After mating, females oviposit alone, often placing the eggs into the tissues of submerged vegetation (4). The eggs take around 14 days to hatch (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The banded demoiselle has the same style of butterfly-like flitting flight as that of the beautiful demoiselle (C. virgo) (3). Males have a metallic bluish-green body with a central band of blackish-blue pigment on the wings. The females are metallic green and lack the band on the wings (3). Males of this species can be distinguished from those of the similar species, the beautiful demoiselle, as the pigmentation on the wing forms a distinct band, whereas in the latter species this is broader and more extensive, covering much of the wing (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Calopteryx splendens extends from western Europe (east of Spain) to Lake Baikal (Russia) and northwest China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

In Britain, this species tends to occur south of a line drawn between Blackpool and Middlesbrough, but with a few scattered populations in the Lake District (3). Elsewhere it is found in central and southern mainland Europe (2), across Asia to China (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Preferred habitats include partially-open running waters, avoiding cold torrents, high mountains and deep shade, and it is scarce on large rivers. Wandering males are often seen far from suitable habitats.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits slow-moving rivers, ponds and other still water-bodies (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calopteryx splendens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATTTTATCACAACAACAATCAATATAAAAACTCCAGGAATAAAAATAGATCAAATGCCATTATTAGTATGGGCAGTAGTAATCACAGCCGTTCTTCTACTACTATCTCTCCCAGTACTTGCTGGA---GCTATTACAATACTACTAACTGACCGTAACATAAATACATCATTCTTCGACCCTGCTGGGGGTGGAGACCCAATTCTATACCAGCATTTATTCTGATTCTTTGGTCACCCCGAAGTATATATCCTAATCCTGCCAGGATTTGGAATAATCTCTCACATTATTGCACAAGAAAGAGGTAAAAAG---GAAACATTCGGAGTATTAGGGATAATCTACGCAATACTAGCAATTGGACTATTAGGATTTGTAGTATGGGCCCACCACATATTTACAGTAGGAATAGATGTAGATACTCGAGCGTACTTTACCTCAGCCACAATAGTAATTGCTGTTCCCACAGGAATTAAAATCTTCAGATGATTA---GCTACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calopteryx splendens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Clausnitzer, V.

Reviewer/s
Kalkman, V. & Suhling. F. (Odonata Red List Authority)

Contributor/s

Justification
Calopteryx splendens is widespread and common in its range. There are a number of continuing threats affecting the species however some conservation measures are in place to prevent further habitat loss.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common and widespread throughout its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Major threats affecting Calopteryx splendens include habitat destruction through both non- and agricultural practices and the associated water pollution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are a variety of conservation measures in place however more are needed. The maintenance and restoration of its preferred habitat is underway, as is the monitoring of the population status and trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation action is not required for this species (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Banded Demoiselle

The Banded Demoiselle (Calopteryx splendens) is a species of damselfly belonging to the family Calopterygidae. It is often found along slow-flowing streams and rivers. It is an Eurasian species occurring from the Atlantic coast eastwards to Lake Baikal and north-western China.[2]

Contents

Identification

This is a large damselfly with a total length of up to 48 millimetres (1.9 in) and a hindwing length of up to 36 millimetres (1.4 in).

The male has translucent wings which each have a broad, dark iridescent blue-black spot (or band) across the outer part. On immature dragonflies the spot is dark brown. The body can be a metallic blue or blue-ish green.

The dark wing patch of the male starts at the nodus (the slight dip midway down the upper edge of the wing) but can reach up to the wing-tip in southern races.[2] In the very similar species C. virgo (Beautiful Demoiselle), the dark starts before the nodus.

The female has translucent, pale green iridescent wings with a white patch near the tip (a pseudopterostigma), and a metallic green body.

Eggs and larvae

Larva of C. splendens

Females can lay up to 10 eggs per minute for 45 minutes. They lay in a wide variety of emergent or floating plants, sometimes even submerging to do so.

The eggs hatch after 14 days. The larvae have very long legs and are stick-shaped. They develop over two years, usually. They tolerate muddy water and overwinter buried in mud. When they are ready to moult into an adult, they climb up a suitable reed or plant and shed their skin.

Behaviour

Males are usually territorial, but large numbers can sometimes be found in lush bankside plants and on floating objects. They court females by opening their wings and performing an aerial dance. They are usually found in canals and quiet rivers with muddy bottoms located in open country.[3]

Natural habitat areas

The Banded Demoiselle is an Eurasian species, and is present throughout Eurasia from the Atlantic coast to Lake Baikal and north-western China.[2] The Demoiselle is found in Taganay and Zyuratkul National Parks of Russia.[4] They also live in National park of Fruška Gora in Serbia. They are found throughout the British Isles, except for the Scottish Highlands.[3]

Status

The Banded Demoiselle is listed as protected in the Red Book of Chelyabinsk Oblast.[4]

Footnotes and references

  1. ^ The dates 1782 and 1776 have been given in the entomological literature; Hämäläinen (2008) showed that the species was described in 1780
  2. ^ a b c Dijkstra, Klaas-Douwe B. (2006). Field Guide to the Dragonflies of Britain and Europe. pp. 66–67. ISBN 0-9531399-4-8. 
  3. ^ a b Brooks & Lewington (2004). Field Guide to the Dragonflies and Damselflies of Great Britain and Ireland. British Wildlife Publishing. ISBN 0-9531399-0-5. 
  4. ^ a b Calopteryx splendens (Harris, 1782) - Красная Книга Челябинской области: животные, растения, грибы / Министерство по радиационной и экологической безопасности Челябинской области, Ин-т экологии растений и животных УрО РАН. - Екатеринбург: Изд-во Урал. ун-та, 2005. - 450 с.: ил.

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!