Overview

Brief Summary

The broad, flat abdomen of both sexes of the Broad-bodied Chaser (Ladona depressa, known until recently as Libellula depressa) is distinctive. The adult male's abdomen is pale blue and he has large dark areas at the wing bases. In the hand, two large spines can be seen on the underside of the first abdominal segment of the male, just in front of the secondary genitalia, that are not present in any other European dragonfly. These dragonflies are strong fliers and are often the first dragonflies to colonize a newly created habitat. They occur in a wide range of (mostly) stagnant water habitats, especially ones that are small, shallow, sunny, and bare, such as drinking pools for cattle or quarry lakes. Females may sometimes oviposit (deposit their eggs) in very unnatural situations such as in the mud under lawn sprinklers. They rarely breed in large water bodies. The flight season runs from April to September, but abundance is generally highest in May and June. Males make fast, direct dashes from a conspicuous perch, often controlling an entire pool by driving away other males.

The Broad-bodied Chaser is among the most common dragonflies across most of Europe to 60° N (although not in Ireland, Scotland, or North Africa and scarce in southern Scandinavia). Its range extends through the Middle East and into western and central Asia. These dragonflies can be found far from water.

(Askew 2004; Dijkstra 2006)

  • Askew, R.R. 2004. The Dragonflies of Europe (2nd edition). Harley Books, Essex, England.
  • Dijkstra, K.-D. B. 2006. Field Guide to the Dragonflies of Britain and Europe. British Wildlife Publishing, Dorset, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ladona depressa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTACCACCTTCTTTCACATTACTTCTTGCTAGAAGAATAGTAGAAAGAGGGGCAGGGACAGGATGAACTGTTTATCCTCCTTTAGCAGGTGCAATTGCACACGCTGGCGCATCAGTAGACTTAACTATTTTTTCCTTACATCTTGCAGGAGTATCTTCAATTTTAGGAGCAATTAATTTCATCACTACTGTAATCAATATAAAATCACCAGGAATAAAGATAGATCAGATACCTTTATTTGTATGAGCGGTAGTAATTACTGCTGTATTATTATTATTATCCTTACCTGTACTTGCAGGAGCAATTACTATGCTTCTTACAGATCGAAATATTAATACCTCTTTTTTTGATCCAGCAGGTGGGGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTTTACCAGGTTTCGGTATAGTATCACACATTATTGCACAGGAAAGAGGAAAAAAGGAAACCTTTGGTATACTAGGAATAATTTATGCCATAGTAGCAATTGGTCTTTTAGGATTTGTAGTATGAGCTCACCACATATTTACTGTAGGAATAGATGTAGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ladona depressa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Libellula depressa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Libellula depressa

Libellula depressa, the broad-bodied chaser or broad-bodied darter,[1] is one of the most common dragonflies in Europe and central Asia. It is very distinctive with a very broad flattened abdomen, four wing patches and, in the male, the abdomen becomes pruinose blue.

Identification[edit]

The male and female have a broad, flattened abdomen which is brown with yellow patches down the sides. In the male the abdomen develops a blue pruinosity that covers the brown colour. Both fore and hind wings have a dark patch at the base. Both the male and female have broad antehumeral stripes. The average wingspan is approximately 70 mm. L. depressa is very distinctive and should not be confused with any other dragonflies in the region.

Variation in the adult

Blue dragonfly
Male L. depressa showing flat, broad abdomen with blue pruinosity
Yellow dragonfly
Female L. depressa showing dark wing bases and yellow spots on the abdomen
Dark dragonfly
Old female L. depressa is much darker than the young female
Broad-bodied Chaser, maturing male, South of France
Broad-bodied Chaser, adult female, South of France
Broad-bodied Chaser, adult female laying, South of France

Distribution and habitat[edit]

L. depressa is found in central and southern Europe, central Asia and the Middle East. It range extends northwards to southern Scotland, southern Sweden and southern Finland and it occurs on some Mediterranean islands including Corsica, Sardinia, Sicily, and Menorca. Its range does not extend beyond southern Europe into Africa.

L. depressa is seen near still-water lakes and ponds, feeding on many types of small insects. They occur in both bare and sunny locations, where it is often the first dragonfly to colonise new habitats such as newly created ponds, and well vegetated ponds. L. depressa are often seen away from water as the adults are very mobile and undergo a period of maturation away from water after emergence. The adults are also migratory.

Behaviour[edit]

The flight period is from April to September but are mostly seen in May and June. Their flight is very fast as they dart and dive above the water. They are very territorial and will fight with rival males and any other dragonflies they happen to encounter.

Hunting and returning to a favoured perch

They characteristically return to a favoured perch, in the sun. When a female enters a male's territory the male will fly up and grab the female. Mating occurs on the wing and the pair are in tandem for only a brief period, often less than a minute. The pair separate and the female will find a suitable location for ovipositing, usually a stretch of open water with submerged vegetation. The female oviposits in flight, hovering above the water and dipping the tip of her abdomen in.

The eggs hatch in 4 or 5 weeks and the larvae take one to two years to develop. The larvae live in the silt and detritus at the bottom of the pond, lying buried in mud with just the head and eyes showing. After emergence the adults move away from water and undergo a period of maturation which lasts 10 to 14 days.

Emergence of the imago

Nymph
Newly emerged adult

Systematics[edit]

This species is usually placed in the genus Libellula but there is some evidence, based on RNA and DNA analysis, that this species should be placed within the genus Ladona (Artiss et al., 2001). This change is not yet generally accepted and books and field guides list this species as Libellula

See also[edit]

References[edit]

  1. ^ Hart. M., et al, (1978), The Naturetrail Omnibus, London: Usborne Publishing Limited, page 157
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!