Overview

Brief Summary

Introduction

Lucanus cervus the stag beetle is Britain’s largest known terrestrial beetle.This magnificent beetle, famed for its antler-like mouthparts and its wrestling style of combat in the competition for a mate, make it a charismatic and emblematic creature of our times.However, it is most commonly known for its rapid population distribution decline in the last 40 years. Habitat loss and landscape fragmentation and in turn the loss of dead wood habitats have directly contributed to this fact. Other factors such as road-kill and predation by common predators such as foxes, cats, and magpies have also impacted on its decline.In many European countries as well as the UK, the stag beetle has protected status. It is listed on Annex II of the EC Habitats Directive and Schedule 5 of the Wildlife and countryside Act 1981. It is also a UK Biodiversity Action Plan species (BAP).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Despite it being such a large and spectacular insect, surprisingly little is known about the habits of the stag beetle. In 1998 the People's Trust for Endangered Species (PTES) invited the public to look for the beetles, asking questions about where they were finding them, the type of wood it was found near, was it eating and so-on. The 'Stag Hunt' revealed that the beetles lay their eggs both in rotting log piles and in the roots of an assortment of rotten trees, including oak, apple, ash and cherry. They seem to have a preference for oak, especially those growing along riverbanks. They also prefer warm places on sandy or light soils, and are now mostly reported from urban and suburban gardens. In fact, seventy percent of the beetles reported were found in gardens. The larvae of the stag beetle live within their rotting logs for up to four years before pupating and emerging as adults at the beginning of the flight season the following year. However, the adults have a much shorter life than the larvae, and only survive for a few months. It used to be thought that adult stag beetles died at the end of the year but, as a result of the survey, it seems some beetles can survive the winter. The main message from the survey was, sadly, that the beetle seems to have declined in numbers greatly, especially in some areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The stag beetle is arguably the most spectacular looking beetle in Britain; the male looks like something from a prehistoric age. The giant antler-like mandibles are used in courtship displays, and wrestling with other males. Although rather fearsome in appearance, the mandibles cannot be closed with any force. You are more likely to be nipped sharply by the female stag beetle, a smaller insect than the male that lacks the huge jaws. The stag beetle, superficially, appears black all over but, in certain lights, it can be seen to have dark maroon or brown wing cases. The impressive mandibles also have a reddish sheen to them. The wing cases are glossy; the head and thorax are a dull black.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Taille : 20-90 mm

Mâles et femelles très différents : la tête du mâle est élargie, plus large encore que le premier segment thoracique, et ses mandibules ont l’aspect des « bois de cerf », ce qui lui vaut son nom vernaculaire de « cerf-volant ». Ces mandibules démesurées lui servent à maintenir la femelle pendant l’accouplement, elles ne sont pas fonctionnelles pour l’alimentation. La femelle n’a que de toutes petites mandibules, et sa tête est de moitié moins large que le premier segment thoracique. Par réciproque avec son mâle, elle porte le nom de « biche ».

Facilité d'identification : simple en dehors du département du Var

Confusions possibles : les petites femelles un peu sombres peuvent être confondues avec le genre voisin Dorcus ( Petite biche ). On les distinguera formellement avec les tibias postérieurs : celui de la femelle de lucane présente trois épines, contre une seule pour celle du Dorcus.

Une deuxième espèce de Lucane cohabite avec L. cervus dans le Var : Lucanus tetraodon La distinction entre ces deux espèces, plus encore pour les femelles, est délicate. Lucanus cervus est absent de Corse, où il est remplacé par L. tetraodon.

Les larves vivent légèrement sous le niveau du sol, dans les vieilles souches en décomposition, dans la majorité des cas d’arbres à feuilles caduques. L’espèce est toutefois aussi signalée des résineux en zone de moyenne montagne, mais ce n’est pas son habitat de prédilection. La vie larvaire peut durer plus de 5 ans. La phase nymphale est quant à elle très courte, elle n’excède pas un mois.

Les adultes se rencontrent en forêt, dans les bocages et dans les parcs urbains, en juin et juillet. Les femelles, qui restent postées dans les arbres avant d’être fécondées, provoquent de grands attroupements de mâles qui iront jusqu’à se battre entre eux. Beaucoup meurent d’épuisement ou sortent mutilés de cette quête. Ils volent essentiellement à la tombée de la nuit. Peu discrets, très lents à la marche comme au vol (handicap provoqué par les mandibules), ils offrent des proies nombreuses, faciles et copieuses à de nombreux prédateurs. On trouve alors de nombreux restes d’individus sur les chemins forestiers. Une fois fécondée, la femelle recherche une souche propice dans laquelle elle s’enfonce et pond.

Autochtone en France, cette espèce à large répartition a subi de nombreuses divisions en nouvelles espèces, hors de nos frontières. Sa répartition actuelle ne dépasserait pas la Turquie vers l’est. Elle est assez commune dans les forêts françaises, particulièrement dans les chênaies de plaine et souvent présente dans les anciens parcs urbains.

Pour plus d’infos, une enquête nationale a été lancée en 2011 par l’OPIE : http://www.insectes.org/enquete/lucane-cerf-volant.html

Références : Baraud J. & Paulian R., 1982. Faune des Coléoptères de France. Lucanoidea et Scarabaeoidea . Ed. Lechevalier, Paris, 473 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Life cycle
The duration of the life cycle, which is a complete metamorphosis is not precise though on average full development can take between 4-6 years. Fully grown adults emerge in the spring with the males emerging first.Adults have a large size range, the males can range from 40mm to 70mm long and are consistently larger than the females, who can be as small as 25mm, and lack the enlarged mandibles of the male. Unlike the males, the females are capable of biting with their mandibles.Both sexes are black with the exception of the wing cases which are a reddish brown. (The female can sometimes be confused with the lesser stage beetle, Dorcus parallelipipedus, but this species has black wing cases). In the male the mandibles are also a reddish-brown.Females lay their eggs in the vicinity of decaying wood, below ground in a prepared bed. Eggs hatch after approximately three weeks. The developing larvae feed on the decaying wood.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

The stag beetle is nothing like as common as it used to be, but is still widespread in southern England, especially the Thames valley, north Essex, south Hampshire and West Sussex. It also occurs fairly frequently in the Severn valley and coastal areas of the south-west. Elsewhere in Britain it is extremely rare or even extinct. This beetle is found throughout Europe, and East Asia as far as Japan, although it is rare or declining in some countries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Stag beetles are found in gardens, wooded parks and pasture woodland; anywhere where there is a good supply of dead wood.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Foodplant / internal feeder
larva of Lucanus cervus feeds within dead or rotten wood of Quercus
Other: major host/prey

Foodplant / internal feeder
larva of Lucanus cervus feeds within dead or rotten wood of esp. stump of Tilia

Foodplant / internal feeder
larva of Lucanus cervus feeds within dead or rotten wood of esp. stump of Ulmus

Foodplant / feeds on
imago of Lucanus cervus feeds on exudate of Broadleaved trees

Foodplant / internal feeder
larva of Lucanus cervus feeds within dead or rotten wood of esp. stump of Fagus

Foodplant / open feeder
imago of Lucanus cervus grazes on fruit of Rosaceae

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Distribution ecology

The stag beetle has a predominantly south to south east distribution in the UK. It is locally common in the Thames valley, and surrounding areas as well as the Severn Valley and parts of the south-west coast. In Europe, it is found in central and southern parts.

Habitat
The natural habitat of the stag beetle is broad leaved woodland, and pasture woodland, favouring oak. However, it can also be found in parks and gardens, particularly in urban areas where they is an abundance of dead wood.The stag beetle is commonly seen in urban habitats at dusk, either walking along the ground (many are run over) or flying to light.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

These beetles are crepuscular, the adult males seen on the wing from May to August where they actively fly about looking for females, especially on warm summer evenings, where they will fly to light.Adults usually only live for a few weeks; their sole adult existence is to mate.Adult stag beetles are not known to feed. However, they do drink sweet fluids such as decomposing fruit and tree sap.

Breeding
During the breeding season, the male stag beetles use their magnificent mandibles as a warning signal to other males, raising them in a defensive and aggressive posture to fight off a contender. They are skilful wrestlers and can even stand up on their hind legs to throw an opponent.There mandibles or mouthparts are sometimes referred to as ‘antlers’ as they resemble and are employed in much the same manner as a deer’s antlers might be, and from which the stag beetle gets its name.Courtship involves the male circling the female with his impressive antlers raised and wide-open. So strong is the mating instinct that males are known to attempt to mate with dead females and as many as four males may attempt to mate with just one female. Once mated the female finds a dead wood habitat to lay her eggs, after which she dies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Larval development

Larval development
Stag beetle larvae are saproxylic, (dependent on dead or dying wood).They are large, c-shaped, and can grow up to 80mm. They are creamy-white with an orange head containing sharp jaws enabling them to tear through fibrous wood. They have 3 pairs of prolegs and due to their tunnelling life-style have no necessity for sight.Larval development is so protracted due to the lack of nourishment gained from the larval foodstuff; thereby development can take as long as six years in unfavourable circumstances. Adult size differentiation may be dependent on the food available to the larval stage.The larvae feed on the decomposing wood by scraping the surface of the wood for splinters. They are particularly fond of wood infested with white rot. The more decomposed the wood, the less energy is expended on breaking up the wood fibre, thereby the larvae develop at a favourable rate.Pupation takes approximately six weeks and begins in the final autumn of the beetle’s life cycle. Once emerged, the adult will remain under ground throughout the winter, until it comes to the surface the following spring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lucanus cervus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GCTCCTGATATAGCTTTTCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCATCCCTAACATTTCTTCTTATAAGAAGTATAATTGAAAGAGGTGCCGGAACAGGGTGAACAGTTTACCCACCCCTCTCATCAAATATTGCCCATAGAGGGGCATCAGTAGACCTA---GCTATTTTCAGTCTTCATCTAGCTGGAATCTCATCTATTTTAGGTGCTGTCAATTTTATTACTACTGTAATTAATATACGGGCAACAGGAATCACCTTCGATCGAATACCCTTATTTGTTTGAGCTGTTGTTTTAACAGCAGTTCTCCTTCTTCTATCTCTACCTGTACTAGCAGGT---GCTATTACTATATTATTAACAGACCGAAATCTTAATACAACCTTTTTCGATCCTGCTGGAGGAGGTGACCCAATCCTTTACCAACATTTATTTTGATTCTTCGGCCACCCAGAAGTGTATATTTTAATTCTACCAGGATTTGGGATAATTTCTCATATCATCAGACAGGAAAGAAGAAAAAAA---GAAACATTTGGAACACTAGGTATAATCTATGCTATAATGGCAATTGGCCTTCTTGGATTCATTGTATGAGCTCATCATATATTTACTGTTGGAATAGATGTGGATACCCGAGCCTACTTCACATCAGCAACTATAATCATTGCTGTTCCTACTGGAATCAAAATTTTTAGTTGACTT---GCTACCCTTCATGGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lucanus cervus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Conservation

What you can do?
Have a look at the natural environment around you and see if it can be improved for harbouring insects, particularly the stag beetle.Decaying dead wood (especially from broad leaved trees such as oak and beech) is an essential component of this beetle’s life-history. Instead of clearing away dead wood and debris, set aside space in your garden for a dead wood pile, some of which should be partially buried, as this is what the young larvae feed upon.If you are cutting down trees, try and leave the stumps.Allow your garden to grow naturally and don’t use mulch or polythene, as newly emerging beetles can become trapped and die.Sometimes stag beetle larvae is found in compost heaps. It is okay to move them to a more suitable environment: just dig a hole, place some dead wood and the larvae in the hole and gently cover over.Many stag beetles are killed on roads and paths, If you spot them, try removing to a natural, secluded environment – they are quite safe to handle.Keep a look out for water bodies such as butts and ponds during the flying season, as beetles often drown – they cannot swim.Join the stag beetle survey and record your sightings which are valuable information for conservationists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed under Annex II of the EC Habitats Directive and Appendix III of the Bern Convention. Protected in the UK under Schedule 5 of the Wildlife and Countryside Act 1981, as amended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

As the beetle grubs take so long to develop, they become extremely vulnerable to tree clearance and the 'tidying up' of wood in parks and especially gardens; the over-zealous tidying of dead timber and stumps is thought to be the chief reason why this spectacular beetle seems to be in decline; although facts about its true status are still unclear. Elsewhere, there may also be a threat caused by the collection of the beetles for sale; to date no evidence of such a trade has been found in the UK. There are a number of websites that offer specimens for sale in the US for about $10 per animal. Whether they are collected from the wild or bred for the purpose is not clear, but if it does occur this practice is probably limited to European countries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

The stag beetle is listed as a priority species under the UK Biodiversity Action Plan (UK BAP), and is included in English Nature's Species Recovery Programme. The People's Trust for Endangered Species is leading a number of programmes to raise the profile of this insect, and have now organised two national surveys to find out more about stag beetle distribution and behaviour and encourage the public to become more sympathetic towards them; the huge response to the first PTES survey suggests that the beetles now have an enthusiastic fan club who may lobby local authorities and owners of large gardens to 'spare that rotten tree!' With regard to the fear that trade in the insects might present a threat, the PTES lobbied the government's advisors and, since April 1998, the stag beetle has been protected under Schedule 5, Section 9.5 of the Wildlife and Countryside Act 1981, which means that all trade in the species is illegal and those suspected of trading in the species can be prosecuted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lucanus cervus

Lucanus cervus is the best-known species of stag beetle in the West (family Lucanidae), and is sometimes referred to simply as the stag beetle. In the UK it is associated with urban gardens, but is more commonly found in forests in the rest of Europe. Forest management, in eliminating old trees and dead wood, eliminates at the same time the habitat and food of this species. Once quite common, the population of the Lucanus cervus, along with that of other species of beetles which feed on dead wood, is in decline, and is now listed as a globally threatened/declining species.

Description[edit]

Sexual dimorphism - male and female
Used for breeding Beetle larvae
Used for breeding Beetle larvae

Adults appear during late May to the beginning of August being most active in the evenings. Females lay their eggs in a piece of decaying wood deep in the soil. Stag beetle larvae, which are blind and shaped like a letter "C", feed on rotting wood in a variety of places, tree stumps, old trees and shrubs, rotting fence posts, compost heaps and leaf mould. The larvae have a cream-coloured soft transparent body with six orange legs, and an orange head which is very distinct from the very sharp brown pincers. They have combs in their legs which they use for communication (stridulation) with other larvae. The larvae go through several developmental stages (instars), taking 4 to 6 years to become pupae. The work of entomologist Charlie Morgan during the late 1970s discovered that the pupae of the stag beetle live in the soil for about 3 months, then emerge in summer to awkwardly fly off to mate. Adults only live for a few weeks, feeding on nectar and tree sap. Their slow, lumbering flight, usually at dusk, makes a distinctive low-pitched buzzing sound. The males fly more readily than the females. The modern Italian word for a toy kite cervo volante (and hence both the French cerf-volant and Spanish ciervo volante) may derive from the ancient amusement of flying the beetles on a length of thread.[citation needed]

The natural reaction of the beetle to an approaching large object is to remain motionless, making them a good photographic subject. Sexually dimorphic, the males have enlarged mandibles and are larger than the females. Although the male's mandibles seem threatening, they are too weak to be harmful. Nevertheless, females can inflict a painful bite. It is the resemblance of the male's mandibles to the horns of a stag, and their use in combat between males, much like with deer, that gives the species its scientific and common names.

Protection[edit]

Lucanus cervus is registered in the second appendix of the Habitats Directive of the European Union from 1992, which requires that member states set aside Special Areas of Conservation. The species is also registered in the third appendix of the Convention on the Conservation of European Wildlife and Natural Habitats (Berne convention) of 1982 and Schedule 5 of the UK's Wildlife and Countryside Act 1981.

List of subspecies[edit]

The best-known subspecies are:

  • Lucanus cervus cervus – Males: 35–92 mm, Females: 35–45 mm; origin: West, Central, East Europe
  • Lucanus cervus akbesianus – Males: 50–100 mm, Females: 40–45 mm; origin: Syria, Turkey
  • Lucanus cervus judaicus – Males: 50–100 mm, Females: 40–50 mm; origin: Syria, Turkey
  • Lucanus cervus turcicus – Males: 35–75 mm, Females: 35–40 mm; origin: Bulgaria, Greece, Turkey

See also[edit]

Further reading[edit]

Harvey, D.J., Gange, A.C., et al. (2011). Bionomics and distribution of the stag beetle, Lucanus cervus (L.) across Europe. Insect Conservation & Diversity 4, 23-38.

  • Bernhard Klausnitzer: Die Hirschkäfer (Lucanidae). [Die Neue Brehm-Bücherei Bd. 551]. Westarp & Spektrum, Magdeburg, Heidelberg, Berlin und Oxford 1995, ISBN 3-89432-451-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!