Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aphrophora alni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACATTATTATTATCAAGAAGTATAGTAGATAATGGTGTAGGAACTGGTTGAACTGTTTACCCTCCTTTATCAAGAGGTATCGCTCATTCAGGTTCTTGTGTAGATTTA---GCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTGTAAATTTTATTACTACTATTTTTAATATACGATCTATTGGAATAAATTTAGATCGAACCCCATTATTTGTTTGATCAGTTTTAATTACAGCTATTCTATTATTATTATCTTTACCAGTTCTAGCAGGA---GCAATCACTATACTATTAACTGATCGTAATTTAAATACATCTTTTTTTGACCCAGCGGGTGGTGGTGATCCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aphrophora alni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Aphrophora alni

Aphrophora alni, the 'European Alder Spittle Bug', is a species belonging to the family Aphrophoridae.

This large 'froghopper' is quite common and widespread. It is present in most of Europe, in eastern Palearctic ecozone, in the Near East and in North Africa.

Aphrophora alni, dorsal view

The adults reach 9–10 millimetres (0.35–0.39 in) of length, the females are usually slightly larger than the males. They can be encountered from May through October on bushes and on several species of trees, especially willows (Salix species), birch (Betula species), alder (Alnus species) and poplar (Populus species).). They inhabit dry and moist habitats of lowlands and mountainous areas, forest edges, hedgerows, meadows, gardens and parks.

The basic coloration of the body is usually brown. Their front wings wear two distinct clear patches on the margins. Head and pronotum have a median keel. The head has a pair of compound eyes and two simple eyes (ocelli). The legs are strongly developed and fit to jump. Tibiae of the rear pair of legs carry several spines.

Aphrophora alni is a polyphagous species, meaning it feeds on several kind of plants. The adults primarily feed on deciduous trees, while larvae prefer herbaceous plants (dicotyledonous).

To lay eggs, the females migrate to the herb layers. The eggs overwinter and hatch the larvae in the following Spring. The larvae live in stems and leaves of herbaceous plants inside the typical foam nest, that protects them against enemies and provide necessary moisture and temperature for their development. Aphrophora alni has only one generation a year.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!