Ecology

Associations

Fungus / parasite
sporangium of Syzygites megalocarpus parasitises fruitbody of Amanita rubescens

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amanita rubescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTCTCTGTTCTTATTAGATTAGAGTTATCTTCTCCTGGAGTTCAATTTTTACAAGGAGATCATCAACTTTTTAATGTTATTATTTCAGCTCACGCATTAATTATGATTTTCTTTATGGTTATGCCTGGTTTAGTAGGTGGATTTGGTAATTACTTTTTACCTATCCATTGTGGGAGTCCTGATATGGCTTTTCCTAGATTAAATAATATTTCATTCTGGTTATTACCGCCTTCATTAATACTATTACTTATTAGTTCATTAGTGGAAAATGGAGCAGGTACTGGTTGGACAATATATCCTCCTTTAGCCGGAATTCAATCACATTCAGGAGGATCGGTAGATTTAGCTATCTTCAGTTTACATCTAGCAGGTGTATCATCATTATTAGGAGCTATAAATTTTATAAGTACAGTACTAAATATGAGAACAAATGGTATGTCATTACATAAATTACCATTATTTGTATGGGCAATATTTGTTACAGCAATATTATTATTATTATCTTTACCAGTATTAGCAGGTGCAATCACAATGTTATTAACAGATAGAAATTTTAATACTAGTTTCTATGACCCTGCTGGTGGTGGTGATCCAATTTTATATCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amanita rubescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blusher

Amanita rubescens and allies'
View the Mycomorphbox template that generates the following list
Mycological characteristics
gills on hymenium
cap is flat
hymenium is free
stipe has a ring
spore print is white
ecology is mycorrhizal
edibility: choice

The Blusher is the common name for several closely related species of the genus Amanita. A. rubescens, found in Europe and eastern North America, and A. novinupta in western North America. Both their scientific and common names are derived from the propensity of their flesh to turn pink on bruising, or cutting. Although edible, it can be confused with deadly poisonous species, and should definitely be avoided by novice mushroomers.

Description[edit]

The European blusher has a reddish-brown convex pileus (cap), that is up to 15 cm across, and strewn with small cream-coloured warts. It is sometimes covered with an ochre-yellow flush which can be washed by the rain. The flesh of the mushroom is white, becoming pink when bruised or exposed to air. This is a key feature in differentiating it from the poisonous False Blusher or Panther cap (Amanita pantherina), whose flesh does not. The stipe (stem) is white with flushes of the cap colour, and grows to a height of up to 15 cm. The gills are white and free of the stem, and display red spots when damaged. The ring is striate (i.e. has ridges) on its upper side, another feature distinguishing it from Amanita pantherina. The spores are white, ovate, amyloid, and approximately 8 by 5 µm in size.

The flavour of the uncooked flesh is mild, but has a faint acrid aftertaste. The smell is not strong.

The mushroom is often attacked by insects.

Distribution and habitat[edit]

It is common throughout much of Europe and eastern North America, growing on poor soils as well as in deciduous or coniferous woodlands. It has also been recorded from South Africa, where it is thought to have been accidentally introduced with trees imported from Europe.[1]

Amanita novinupta[edit]

A species found in the western U.S., only recently formally described and until then frequently misidentified as A. rubescens; see MykoWeb - Fungi of California - Amanita novinupta for details.

Other species[edit]

Closely related species include Amanita brunneolocularis, A. orsonii, A. rubescens var. alba, and A. rubescens var. congolensis.[2]

Uses[edit]

Both of these species are edible when cooked. European Amanita rubescens is known to contain a hemolytic poison in its raw state; it is unknown whether North American A. rubescens and A. novinupta are similarly toxic in its raw state. This toxin is destroyed by cooking.

Amanita novinupta is highly regarded as a choice edible in the region in which it is found. However, the edibility of blusher species other than A. rubescens and A. novinupta has not been established and experimentation is not advised.

See also[edit]

References[edit]

  1. ^ Reid DA, Eicker A (1991). "South African fungi: the genus Amanita" (PDF). Mycological Research 95: 80–95. doi:10.1016/S0953-7562(09)81364-6. Retrieved 2007-11-13. 
  2. ^ http://pluto.njcc.com/~ret/amanita/species/brunlocu.html
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!