Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Eupithecia pusillata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eupithecia pusillata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCTTATATTTTATTTTTGGAATTTGAGCAGGCATAATTGGAACCTCTTTAAGATTACTAATTCGAGCCGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTCATCATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGTAATTGACTAGTACCTCTAATATTAGGAGCACCTGATATAGCTTTCCCTCGAATAAATAATATAAGCTTTTGATTATTACCCCCCTCTATCACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACTGGATGAACAGTTTATCCTCCTTTATCATCTAATATTGCACATGGGGGAAGTTCTGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCTATTTTAGGAGCCATCNATTTTATTACAACTATTATTAATATACGTTTAAATAATATATTTTTTGATCAATTACCTTTATTTGTTTGAGCTGTAGGAATTACAGCTTTTTTACTTCTTTTATCTTTACCCGTTTTAGCTGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACCTCATTTTTCGATCCCGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Juniper Pug

The Juniper Pug or Juniper Looper (Eupithecia pusillata) is a moth of the family Geometridae. It is found throughout the Palearctic and Nearctic regions and the Near East.

Subspecies interruptofasciata is sometimes treated as a valid species Eupithecia interruptofasciata.

The forewings are greyish brown with two distinctive black bands. The wingspan is 17–21 mm. The adults fly at night from July to September [1] and are attracted to light.

In the Old World the larva feeds on Juniperus (juniper) and also on some other conifers in the cypress family such as Chamaecyparis and Thuja. In the New World there is a greater range of recorded food plants including apple, clover, raspberry, redcurrant, strawberry, sunflower and willow as well as juniper. The species overwinters as an egg.

  1. ^ The flight season refers to the British Isles. This may vary in other parts of the range.

Subspecies[edit]

References[edit]

  1. ^ Taxapad
  2. ^ Mironov, V.G. ,A.C. Galsworthy & U. Ratzel, 2008, A survey of the Eupithecia fauna (Lepidoptera: Geometridae) of the Western Himalayas: Part 2, Transactions of the Lepidopterological Society of Japan 59 (2): 117-143.
  • Chinery, Michael Collins Guide to the Insects of Britain and Western Europe 1986 (Reprinted 1991)
  • Skinner, Bernard Colour Identification Guide to Moths of the British Isles 1984


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!