Molecular Biology and Genetics

Molecular Biology

Barcode data: Eupithecia expallidata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATACTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATATTGGGAGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTACCTCCCTCTATTACATTATTAATCTCAAGAAGAATTGTAGAAAATGGGGCTGGTACTGGGTGAACAGTATACCCCCCTTTATCTTCTAATATTGCTCATGGAGGGAGCTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGTTTAAATAACATATTTTTTGATCAATTACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTTTTACTTCTTTTATCTTTACCTGTTTTAGCTGGTGCTATTACAATACTTTTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCTGCGGGAGGTGGAGACCCTATCCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eupithecia expallidata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eupithecia expallidata

The Bleached Pug (Eupithecia expallidata) is a moth of the family Geometridae. It is found in North-West and Central Russia, South-East Scandinavia to the North Mediterranean and West Europe including the British Isles.[2][3][4]

The wingspan is 20–24 mm.[3][5] The forewings are broad and rounded. The ground colour is pale light brown.There are two black costal stains and a large black discal stain. A fine broken black line runs around the outer margin of the forewing. The hindwings are similar and have a small discal spot.

The moth flies in July and August.

The larvae feed on goldenrod (Solidago virgaurea).[5][6]

References[edit]

  1. ^ Taxapad
  2. ^ Markku Savela. "Eupithecia expallidata". funet.fi. Retrieved 26 January 2013. 
  3. ^ a b Christopher Jonko (2011). "Eupithecia expallidata". lepidoptera.pl. Retrieved 26 January 2013. 
  4. ^ Mike Wall. "1833 Bleached Pug (Eupithecia expallidata)". Hants Moths. Retrieved 26 January 2013. 
  5. ^ a b Ian Kimber. "1833 Bleached Pug Eupithecia expallidata". UKMoths. Retrieved 26 January 2013. 
  6. ^ Richard South (1909). "The Moths of the British Isles, Second Series". Frederick Warne & Co. (Wikisource). Retrieved 26 January 2013. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!